Incidental Mutation 'R0082:Wdr91'
ID60624
Institutional Source Beutler Lab
Gene Symbol Wdr91
Ensembl Gene ENSMUSG00000058486
Gene NameWD repeat domain 91
Synonyms
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R0082 (G1)
Quality Score124
Status Validated
Chromosome6
Chromosomal Location34880426-34910876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34906685 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 132 (R132G)
Ref Sequence ENSEMBL: ENSMUSP00000120805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081214] [ENSMUST00000133336] [ENSMUST00000146968] [ENSMUST00000149448] [ENSMUST00000152488]
Predicted Effect probably benign
Transcript: ENSMUST00000081214
AA Change: R184G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079974
Gene: ENSMUSG00000058486
AA Change: R184G

DomainStartEndE-ValueType
Blast:LisH 5 36 3e-6 BLAST
coiled coil region 179 228 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
WD40 393 437 6.34e-2 SMART
WD40 442 480 3.42e1 SMART
Blast:WD40 483 525 1e-19 BLAST
WD40 552 591 1.88e-4 SMART
WD40 594 633 3.96e-3 SMART
WD40 701 742 8.59e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000133336
AA Change: R132G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145765
Predicted Effect probably benign
Transcript: ENSMUST00000146968
AA Change: R184G

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138406
Gene: ENSMUSG00000058486
AA Change: R184G

DomainStartEndE-ValueType
Blast:LisH 5 36 2e-6 BLAST
coiled coil region 179 228 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
WD40 393 437 6.34e-2 SMART
WD40 442 480 3.42e1 SMART
Blast:WD40 483 525 1e-19 BLAST
WD40 552 591 1.48e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149448
AA Change: R132G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000120164
Gene: ENSMUSG00000058486
AA Change: R132G

DomainStartEndE-ValueType
coiled coil region 127 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201569
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Wdr91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Wdr91 APN 6 34909543 splice site probably benign
IGL01340:Wdr91 APN 6 34904579 missense probably benign 0.00
IGL01402:Wdr91 APN 6 34889063 missense probably benign
IGL02632:Wdr91 APN 6 34889042 missense probably damaging 1.00
IGL03104:Wdr91 APN 6 34905556 missense probably benign 0.00
IGL03169:Wdr91 APN 6 34905491 missense possibly damaging 0.93
R0080:Wdr91 UTSW 6 34906685 missense possibly damaging 0.81
R0422:Wdr91 UTSW 6 34880846 missense probably damaging 1.00
R1738:Wdr91 UTSW 6 34884308 missense probably damaging 1.00
R1993:Wdr91 UTSW 6 34892362 missense probably damaging 1.00
R1994:Wdr91 UTSW 6 34892362 missense probably damaging 1.00
R3115:Wdr91 UTSW 6 34905587 missense probably damaging 0.98
R3116:Wdr91 UTSW 6 34905587 missense probably damaging 0.98
R4261:Wdr91 UTSW 6 34904522 missense possibly damaging 0.84
R4760:Wdr91 UTSW 6 34908299 missense probably damaging 0.96
R4977:Wdr91 UTSW 6 34910791 missense probably damaging 1.00
R5093:Wdr91 UTSW 6 34892353 missense probably damaging 1.00
R5910:Wdr91 UTSW 6 34891487 missense possibly damaging 0.93
R6788:Wdr91 UTSW 6 34886819 missense probably damaging 0.99
R7139:Wdr91 UTSW 6 34908263 missense possibly damaging 0.82
R7195:Wdr91 UTSW 6 34889274 missense possibly damaging 0.70
R7268:Wdr91 UTSW 6 34892440 missense probably benign
R7303:Wdr91 UTSW 6 34884323 missense probably benign 0.01
R7326:Wdr91 UTSW 6 34904626 missense probably damaging 0.99
R7341:Wdr91 UTSW 6 34891460 missense possibly damaging 0.49
R7362:Wdr91 UTSW 6 34889115 missense possibly damaging 0.50
X0026:Wdr91 UTSW 6 34909372 missense probably benign 0.03
Z1177:Wdr91 UTSW 6 34891500 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGCTGCCTCGTTGCTCATGAAG -3'
(R):5'- TGAGTCCAGAAGAGTCAGGTGGTC -3'

Sequencing Primer
(F):5'- AATCTTACCAGAGCTGGTGC -3'
(R):5'- TCTAGAGTAGCAGGCCCAG -3'
Posted On2013-07-24