Incidental Mutation 'R0082:Pomgnt2'
ID60626
Institutional Source Beutler Lab
Gene Symbol Pomgnt2
Ensembl Gene ENSMUSG00000066235
Gene Nameprotein O-linked mannose beta 1,4-N-acetylglucosaminyltransferase 2
SynonymsC85492, Gtdc2
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0082 (G1)
Quality Score196
Status Validated
Chromosome9
Chromosomal Location121981606-121997110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121982260 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 485 (V485E)
Ref Sequence ENSEMBL: ENSMUSP00000149753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043011] [ENSMUST00000084743] [ENSMUST00000213773] [ENSMUST00000214511] [ENSMUST00000214533] [ENSMUST00000214536] [ENSMUST00000215084] [ENSMUST00000215990] [ENSMUST00000216669] [ENSMUST00000217610]
Predicted Effect probably benign
Transcript: ENSMUST00000043011
SMART Domains Protein: ENSMUSP00000040221
Gene: ENSMUSG00000038233

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
Pfam:FAM198 220 544 1.3e-150 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084743
AA Change: V485E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095868
Gene: ENSMUSG00000066235
AA Change: V485E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 29 38 N/A INTRINSIC
Pfam:DUF563 162 395 1.7e-25 PFAM
low complexity region 462 475 N/A INTRINSIC
SCOP:d1f6fb2 482 580 6e-9 SMART
Blast:FN3 486 570 2e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000213773
Predicted Effect probably benign
Transcript: ENSMUST00000214511
Predicted Effect probably benign
Transcript: ENSMUST00000214533
Predicted Effect probably benign
Transcript: ENSMUST00000214536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215008
Predicted Effect probably benign
Transcript: ENSMUST00000215084
Predicted Effect probably benign
Transcript: ENSMUST00000215990
Predicted Effect probably damaging
Transcript: ENSMUST00000216669
AA Change: V485E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217610
AA Change: V485E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.8880 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with glycosyltransferase activity although its function is not currently known. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased birth body size and complete neonatal lethality associated with abnormal basal lamina formation and a neuronal migration defect due to a lack of laminin-binding glycans on alpha-dystroglycan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Pomgnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Pomgnt2 APN 9 121983125 missense probably benign 0.03
IGL01911:Pomgnt2 APN 9 121982788 missense probably benign 0.05
IGL01943:Pomgnt2 APN 9 121982470 missense probably benign 0.06
IGL02955:Pomgnt2 APN 9 121982890 missense probably damaging 1.00
H8441:Pomgnt2 UTSW 9 121982584 missense probably damaging 1.00
R0080:Pomgnt2 UTSW 9 121982260 missense probably damaging 1.00
R0602:Pomgnt2 UTSW 9 121982273 missense probably benign 0.02
R0715:Pomgnt2 UTSW 9 121982061 missense probably damaging 1.00
R1491:Pomgnt2 UTSW 9 121982260 missense probably damaging 1.00
R1908:Pomgnt2 UTSW 9 121982191 missense possibly damaging 0.89
R1909:Pomgnt2 UTSW 9 121982191 missense possibly damaging 0.89
R2041:Pomgnt2 UTSW 9 121982288 missense probably benign 0.00
R4428:Pomgnt2 UTSW 9 121982254 missense possibly damaging 0.71
R4578:Pomgnt2 UTSW 9 121983065 missense probably damaging 1.00
R4910:Pomgnt2 UTSW 9 121982947 missense probably benign 0.19
R4937:Pomgnt2 UTSW 9 121982554 missense probably benign 0.05
R5409:Pomgnt2 UTSW 9 121982237 missense possibly damaging 0.71
R6090:Pomgnt2 UTSW 9 121982797 missense probably damaging 1.00
R6596:Pomgnt2 UTSW 9 121982254 missense possibly damaging 0.71
R7152:Pomgnt2 UTSW 9 121983523 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCACACCAGGTAGGTGGTAAAAG -3'
(R):5'- AAACATGATCCGGGAGAACACAGTC -3'

Sequencing Primer
(F):5'- AAAAGGTTTGATGTTCTCTGTGAAG -3'
(R):5'- GTCACACACCCTGAGCG -3'
Posted On2013-07-24