Incidental Mutation 'R7840:Setbp1'
ID606261
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.380) question?
Stock #R7840 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78783424 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1325 (P1325S)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect probably benign
Transcript: ENSMUST00000025430
AA Change: P1325S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: P1325S

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik A G 2: 132,750,590 T186A probably damaging Het
Abca16 A G 7: 120,475,466 N577S probably benign Het
Ang4 A G 14: 51,764,072 S140P probably damaging Het
Ankdd1b T C 13: 96,419,798 probably null Het
Anln G T 9: 22,362,723 A606D probably benign Het
Ano5 T G 7: 51,587,732 V768G possibly damaging Het
Ccdc180 A T 4: 45,900,461 Y275F possibly damaging Het
Chpf T C 1: 75,476,627 Y334C probably damaging Het
Chrdl2 T C 7: 100,033,656 L381S probably damaging Het
Cox20 A T 1: 178,322,561 Y100F probably benign Het
Dbn1 T C 13: 55,475,509 D433G possibly damaging Het
Dclre1a A T 19: 56,531,252 I983N probably damaging Het
Dok6 A T 18: 89,560,058 H78Q probably benign Het
Dusp9 AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG AAGGCCGAACCTAAGGCTGAAGCGGAGGCCGAACCTAAGGCTGAAGCGGAG X: 73,640,522 probably benign Het
Fam35a A G 14: 34,237,566 Y820H probably damaging Het
Fam92b T C 8: 120,166,633 D273G probably benign Het
Fpr1 A T 17: 17,877,372 F118L probably benign Het
Fscn3 A G 6: 28,430,176 Y115C probably damaging Het
Gm11639 G A 11: 104,733,713 D878N probably benign Het
Gm45861 T C 8: 27,582,723 V1290A unknown Het
Hivep1 T C 13: 42,155,352 V356A probably benign Het
Ikbip T C 10: 91,101,755 Y97H possibly damaging Het
Il10 A G 1: 131,020,068 T53A probably benign Het
Inpp5f T C 7: 128,694,802 V959A probably benign Het
Insr T C 8: 3,258,415 E207G probably benign Het
Kndc1 T A 7: 139,923,816 S1012T probably damaging Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Ksr2 T C 5: 117,555,264 V259A probably benign Het
Lox A T 18: 52,525,122 Y326* probably null Het
Lpin2 C A 17: 71,230,274 T272N probably benign Het
Lrp2 C T 2: 69,464,784 E3397K probably damaging Het
Megf11 G A 9: 64,695,427 C850Y possibly damaging Het
Morc1 T C 16: 48,498,784 F284L probably benign Het
Moxd2 T A 6: 40,885,444 D147V possibly damaging Het
Mrpl21 T C 19: 3,287,752 L153P probably damaging Het
Naip2 T C 13: 100,144,409 T1432A probably benign Het
Naip6 T A 13: 100,315,471 D211V probably damaging Het
Ncoa5 T C 2: 165,012,896 H102R possibly damaging Het
Ndel1 A T 11: 68,829,980 C293* probably null Het
Ninl A T 2: 150,966,096 M82K probably benign Het
Nrcam G A 12: 44,541,075 probably null Het
Nup210l A T 3: 90,122,729 I250L probably benign Het
Obscn T C 11: 59,077,950 E2532G possibly damaging Het
Olfr1062 A G 2: 86,423,239 F146L probably benign Het
Olfr110 G T 17: 37,498,977 G109C probably damaging Het
Olfr20 C A 11: 73,353,759 A2E probably benign Het
Osgin1 G A 8: 119,445,034 S189N possibly damaging Het
Otud7b A G 3: 96,155,373 E643G probably damaging Het
Phldb2 T A 16: 45,751,364 T1222S probably damaging Het
Pwp1 C T 10: 85,888,050 R472W probably damaging Het
Rad21 T C 15: 51,973,142 Y211C probably damaging Het
Rexo1 A G 10: 80,550,738 V162A probably benign Het
Rtl1 C T 12: 109,594,155 V417I probably benign Het
Skint7 G T 4: 111,982,226 C239F probably benign Het
Slc25a1 A G 16: 17,926,274 L221P probably benign Het
Snrnp70 T A 7: 45,376,790 D385V unknown Het
Sp7 A C 15: 102,359,098 V109G probably benign Het
Syne1 A T 10: 5,132,078 Y849N probably damaging Het
Tas2r108 T C 6: 40,493,856 F89L possibly damaging Het
Tcf3 C T 10: 80,410,467 A581T possibly damaging Het
Tcrg-C1 A T 13: 19,216,521 Y140F Het
Tcta A G 9: 108,305,787 L53P probably damaging Het
Traf3ip2 C G 10: 39,626,455 Q200E probably damaging Het
Tyk2 A T 9: 21,124,967 C75S probably damaging Het
Ugt3a1 G A 15: 9,311,817 G382R probably damaging Het
Upp2 G T 2: 58,774,115 probably null Het
Vmn1r212 A T 13: 22,883,153 F337I unknown Het
Vmn1r58 T C 7: 5,411,243 probably benign Het
Vps13d A T 4: 145,103,676 V2856D Het
Wdr37 A C 13: 8,836,875 L292R probably damaging Het
Yipf3 T C 17: 46,250,864 I199T probably benign Het
Zdhhc23 A G 16: 43,971,544 S289P possibly damaging Het
Zfp229 A T 17: 21,746,150 K454* probably null Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 unclassified probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7134:Setbp1 UTSW 18 78859519 missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
R7849:Setbp1 UTSW 18 78856853 missense probably benign 0.00
R7923:Setbp1 UTSW 18 78783424 missense probably benign 0.03
R7932:Setbp1 UTSW 18 78856853 missense probably benign 0.00
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATGGGCAAAGAACTCACCTGC -3'
(R):5'- GAGTCAGGTGAATCCCTTCC -3'

Sequencing Primer
(F):5'- CATCCGATGTTGCTGCAGATGC -3'
(R):5'- GTCAGGTGAATCCCTTCCAAACG -3'
Posted On2019-12-20