Incidental Mutation 'R7841:Foxs1'
ID606277
Institutional Source Beutler Lab
Gene Symbol Foxs1
Ensembl Gene ENSMUSG00000074676
Gene Nameforkhead box S1
SynonymsFkh3, FREAC10, Fkhl18
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location152931898-152933208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152932987 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 49 (M49L)
Ref Sequence ENSEMBL: ENSMUSP00000096806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099200]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099200
AA Change: M49L

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096806
Gene: ENSMUSG00000074676
AA Change: M49L

DomainStartEndE-ValueType
FH 16 106 1.88e-60 SMART
low complexity region 269 283 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The forkhead family of transcription factors belongs to the winged helix class of DNA-binding proteins. The protein encoded by this intronless gene contains a forkhead domain and is found predominantly in aorta and kidney. The function of the encoded protein is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for one reporter allele display enhanced rotarod performance and increased male resistance to diet-induced obesity. Homozygotes for another reporter allele show impaired testicular vasculature, including blood accumulation in fetal testis and marked apoptosis of periendothelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Foxs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Foxs1 APN 2 152932312 missense probably benign
IGL02304:Foxs1 APN 2 152932350 missense probably benign 0.01
IGL02491:Foxs1 APN 2 152932801 missense probably damaging 1.00
IGL03009:Foxs1 APN 2 152932929 missense probably damaging 1.00
IGL03046:Foxs1 UTSW 2 152932564 missense probably benign 0.00
R0158:Foxs1 UTSW 2 152932410 missense probably damaging 1.00
R0324:Foxs1 UTSW 2 152932687 missense probably benign 0.02
R1616:Foxs1 UTSW 2 152932639 missense probably benign 0.37
R1915:Foxs1 UTSW 2 152932840 missense probably damaging 0.99
R3113:Foxs1 UTSW 2 152932236 missense probably benign 0.00
R4885:Foxs1 UTSW 2 152932381 missense probably benign 0.00
R6084:Foxs1 UTSW 2 152932842 missense possibly damaging 0.81
R6265:Foxs1 UTSW 2 152932178 nonsense probably null
R6720:Foxs1 UTSW 2 152932720 missense probably damaging 0.99
R6828:Foxs1 UTSW 2 152933128 nonsense probably null
R6845:Foxs1 UTSW 2 152932699 missense probably benign
R7456:Foxs1 UTSW 2 152933125 missense probably benign
R7577:Foxs1 UTSW 2 152932441 missense probably benign 0.01
R7746:Foxs1 UTSW 2 152933108 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTGGAACATGTCGTGGC -3'
(R):5'- GTGGGTCTCTTAACAGCCTG -3'

Sequencing Primer
(F):5'- AACATGTCGTGGCAGTCC -3'
(R):5'- ATCGCCAGCTCTGAATACCGTG -3'
Posted On2019-12-20