Incidental Mutation 'R7841:Npr1'
ID606279
Institutional Source Beutler Lab
Gene Symbol Npr1
Ensembl Gene ENSMUSG00000027931
Gene Namenatriuretic peptide receptor 1
SynonymsNPRA, guanylyl cyclase-A, GC-A, NPR-A
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location90450591-90465866 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90454868 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 990 (L990H)
Ref Sequence ENSEMBL: ENSMUSP00000029540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029540]
Predicted Effect probably damaging
Transcript: ENSMUST00000029540
AA Change: L990H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029540
Gene: ENSMUSG00000027931
AA Change: L990H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 50 410 4.7e-54 PFAM
low complexity region 468 488 N/A INTRINSIC
Pfam:Pkinase_Tyr 538 797 1.2e-39 PFAM
Pfam:Pkinase 543 796 8.7e-31 PFAM
CYCc 836 1030 5.04e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124760
SMART Domains Protein: ENSMUSP00000118023
Gene: ENSMUSG00000027931

DomainStartEndE-ValueType
PDB:3A3K|B 2 20 1e-8 PDB
transmembrane domain 25 47 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Guanylyl cyclases, catalyzing the production of cGMP from GTP, are classified as soluble and membrane forms (Garbers and Lowe, 1994 [PubMed 7982997]). The membrane guanylyl cyclases, often termed guanylyl cyclases A through F, form a family of cell-surface receptors with a similar topographic structure: an extracellular ligand-binding domain, a single membrane-spanning domain, and an intracellular region that contains a protein kinase-like domain and a cyclase catalytic domain. GC-A and GC-B function as receptors for natriuretic peptides; they are also referred to as atrial natriuretic peptide receptor A (NPR1) and type B (NPR2; MIM 108961). Also see NPR3 (MIM 108962), which encodes a protein with only the ligand-binding transmembrane and 37-amino acid cytoplasmic domains. NPR1 is a membrane-bound guanylate cyclase that serves as the receptor for both atrial and brain natriuretic peptides (ANP (MIM 108780) and BNP (MIM 600295), respectively).[supplied by OMIM, May 2009]
PHENOTYPE: Homozygous inactivation of this gene can lead to hypertension, cardiac hypertrophy, lethal vascular events, congestive heart failure in response to volume overload, reduced serum testosterone levels, altered steroidogenesis, and reduced myocardial PMN infiltration and infarct size after I/R injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Npr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Npr1 APN 3 90458362 missense probably damaging 1.00
IGL01432:Npr1 APN 3 90463236 missense possibly damaging 0.85
IGL02106:Npr1 APN 3 90464858 missense probably benign 0.12
IGL03310:Npr1 APN 3 90455991 missense probably benign 0.30
PIT4581001:Npr1 UTSW 3 90462257 missense probably damaging 1.00
R0010:Npr1 UTSW 3 90454832 missense probably damaging 1.00
R0137:Npr1 UTSW 3 90455937 missense probably damaging 1.00
R0384:Npr1 UTSW 3 90465167 missense probably damaging 0.98
R0656:Npr1 UTSW 3 90461369 missense probably benign
R0941:Npr1 UTSW 3 90461409 missense probably benign
R0961:Npr1 UTSW 3 90458721 missense possibly damaging 0.91
R1172:Npr1 UTSW 3 90461382 missense probably benign 0.01
R1747:Npr1 UTSW 3 90458669 missense possibly damaging 0.88
R1763:Npr1 UTSW 3 90459337 missense probably damaging 0.98
R1900:Npr1 UTSW 3 90462188 missense probably damaging 0.98
R3807:Npr1 UTSW 3 90458726 missense probably damaging 0.98
R4017:Npr1 UTSW 3 90456232 missense probably damaging 1.00
R4437:Npr1 UTSW 3 90456286 missense probably damaging 1.00
R4900:Npr1 UTSW 3 90455965 missense possibly damaging 0.77
R5265:Npr1 UTSW 3 90457002 missense probably benign 0.29
R5343:Npr1 UTSW 3 90458208 missense possibly damaging 0.94
R5590:Npr1 UTSW 3 90454842 missense probably damaging 0.99
R5868:Npr1 UTSW 3 90459493 intron probably benign
R6782:Npr1 UTSW 3 90456253 missense probably benign 0.18
R6828:Npr1 UTSW 3 90464813 missense probably benign
R6903:Npr1 UTSW 3 90455145 missense possibly damaging 0.67
R7592:Npr1 UTSW 3 90465016 missense possibly damaging 0.52
R7924:Npr1 UTSW 3 90454868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGTTTTCAACCCCATGTG -3'
(R):5'- GAGACTAAACCTTTATCCCCTGTC -3'

Sequencing Primer
(F):5'- CACACACACCAATTGTCTTGATTTAC -3'
(R):5'- CTCTCTCCACACACCCTGGG -3'
Posted On2019-12-20