Incidental Mutation 'R7841:Slc6a17'
ID606282
Institutional Source Beutler Lab
Gene Symbol Slc6a17
Ensembl Gene ENSMUSG00000027894
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 17
SynonymsNTT4, D130012J15Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location107467543-107518018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107476898 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 377 (Y377N)
Ref Sequence ENSEMBL: ENSMUSP00000129379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029499] [ENSMUST00000168211] [ENSMUST00000169449]
Predicted Effect probably benign
Transcript: ENSMUST00000029499
AA Change: Y377N

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000029499
Gene: ENSMUSG00000027894
AA Change: Y377N

DomainStartEndE-ValueType
Pfam:SNF 60 640 2.7e-227 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168211
AA Change: Y336N

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131888
Gene: ENSMUSG00000027894
AA Change: Y336N

DomainStartEndE-ValueType
Pfam:SNF 19 602 1.3e-225 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000169449
AA Change: Y377N

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129379
Gene: ENSMUSG00000027894
AA Change: Y377N

DomainStartEndE-ValueType
Pfam:SNF 60 643 1.1e-225 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. Defects in this gene are a cause of autosomal recessive mental retardation-48. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Slc6a17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02432:Slc6a17 APN 3 107493177 missense possibly damaging 0.56
IGL02514:Slc6a17 APN 3 107495677 missense possibly damaging 0.94
IGL03395:Slc6a17 APN 3 107477306 missense probably damaging 1.00
R0454:Slc6a17 UTSW 3 107476867 missense probably benign 0.12
R1201:Slc6a17 UTSW 3 107493072 missense possibly damaging 0.90
R1551:Slc6a17 UTSW 3 107472127 missense possibly damaging 0.85
R1681:Slc6a17 UTSW 3 107474386 missense probably damaging 1.00
R1721:Slc6a17 UTSW 3 107472176 missense probably damaging 1.00
R1765:Slc6a17 UTSW 3 107473579 missense possibly damaging 0.95
R1867:Slc6a17 UTSW 3 107472176 missense probably damaging 1.00
R2167:Slc6a17 UTSW 3 107491501 nonsense probably null
R3708:Slc6a17 UTSW 3 107493085 missense probably benign
R3814:Slc6a17 UTSW 3 107471317 missense possibly damaging 0.92
R4639:Slc6a17 UTSW 3 107474281 missense probably benign
R4807:Slc6a17 UTSW 3 107500487 missense possibly damaging 0.90
R5048:Slc6a17 UTSW 3 107471437 nonsense probably null
R6076:Slc6a17 UTSW 3 107472071 missense possibly damaging 0.67
R6326:Slc6a17 UTSW 3 107500406 missense probably damaging 0.98
R6713:Slc6a17 UTSW 3 107471387 missense probably benign 0.00
R7073:Slc6a17 UTSW 3 107471439 missense probably benign 0.00
R7097:Slc6a17 UTSW 3 107493148 missense probably damaging 1.00
R7323:Slc6a17 UTSW 3 107491478 missense probably benign 0.01
R7597:Slc6a17 UTSW 3 107471352 missense possibly damaging 0.89
R7755:Slc6a17 UTSW 3 107474355 missense probably damaging 1.00
R7924:Slc6a17 UTSW 3 107476898 missense possibly damaging 0.69
R8041:Slc6a17 UTSW 3 107474428 missense probably damaging 1.00
X0010:Slc6a17 UTSW 3 107493106 missense probably benign 0.05
X0062:Slc6a17 UTSW 3 107500368 missense probably null 1.00
Z1176:Slc6a17 UTSW 3 107476766 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAAGCCTATCTCTGGGTTCCTG -3'
(R):5'- TGAGACCATCATCTTCCTCAGC -3'

Sequencing Primer
(F):5'- AGCCTGTTCCGGTACCTTG -3'
(R):5'- ACCATCATCTTCCTCAGCCTTGG -3'
Posted On2019-12-20