Incidental Mutation 'R7841:Cic'
ID606296
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Namecapicua transcriptional repressor
Synonyms1200010B10Rik
Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25267704-25294159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25285767 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1146 (Y1146C)
Ref Sequence ENSEMBL: ENSMUSP00000132351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000165239] [ENSMUST00000169266]
Predicted Effect probably damaging
Transcript: ENSMUST00000005578
AA Change: Y239C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: Y239C

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163320
AA Change: Y239C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: Y239C

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165239
AA Change: Y239C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: Y239C

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: Y1146C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: Y1146C

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 25292124 missense probably damaging 1.00
IGL01668:Cic APN 7 25291204 missense possibly damaging 0.47
IGL02229:Cic APN 7 25290950 missense probably damaging 0.96
IGL02506:Cic APN 7 25290857 missense probably benign
IGL02794:Cic APN 7 25285644 missense probably damaging 1.00
IGL03065:Cic APN 7 25285821 splice site probably benign
IGL03304:Cic APN 7 25284849 missense probably damaging 1.00
1mM(1):Cic UTSW 7 25290789 splice site probably benign
IGL03046:Cic UTSW 7 25291075 missense probably damaging 1.00
R0012:Cic UTSW 7 25287140 missense probably damaging 0.98
R0012:Cic UTSW 7 25287141 missense probably damaging 1.00
R0027:Cic UTSW 7 25287140 missense probably damaging 0.98
R0027:Cic UTSW 7 25287141 missense probably damaging 1.00
R0038:Cic UTSW 7 25287140 missense probably damaging 0.98
R0038:Cic UTSW 7 25287141 missense probably damaging 1.00
R0063:Cic UTSW 7 25287140 missense probably damaging 0.98
R0063:Cic UTSW 7 25287141 missense probably damaging 1.00
R0064:Cic UTSW 7 25287140 missense probably damaging 0.98
R0064:Cic UTSW 7 25287141 missense probably damaging 1.00
R0118:Cic UTSW 7 25286034 missense probably damaging 1.00
R0193:Cic UTSW 7 25287140 missense probably damaging 0.98
R0193:Cic UTSW 7 25287141 missense probably damaging 1.00
R0241:Cic UTSW 7 25287140 missense probably damaging 0.98
R0241:Cic UTSW 7 25287141 missense probably damaging 1.00
R0377:Cic UTSW 7 25285799 missense probably damaging 0.98
R0462:Cic UTSW 7 25287140 missense probably damaging 0.98
R0462:Cic UTSW 7 25287141 missense probably damaging 1.00
R0800:Cic UTSW 7 25285237 missense probably benign
R1253:Cic UTSW 7 25290948 missense probably damaging 1.00
R1458:Cic UTSW 7 25279737 intron probably benign
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1462:Cic UTSW 7 25271607 missense probably damaging 0.98
R1519:Cic UTSW 7 25293810 critical splice acceptor site probably null
R1586:Cic UTSW 7 25285961 missense probably damaging 1.00
R1824:Cic UTSW 7 25288266 missense probably damaging 1.00
R1908:Cic UTSW 7 25286840 missense probably damaging 1.00
R2045:Cic UTSW 7 25271536 missense possibly damaging 0.53
R2063:Cic UTSW 7 25273451 missense probably damaging 0.98
R2161:Cic UTSW 7 25288134 unclassified probably null
R2495:Cic UTSW 7 25291776 splice site probably benign
R2865:Cic UTSW 7 25273221 missense probably damaging 0.96
R3692:Cic UTSW 7 25288913 nonsense probably null
R3709:Cic UTSW 7 25286981 missense probably damaging 0.99
R3710:Cic UTSW 7 25286981 missense probably damaging 0.99
R3872:Cic UTSW 7 25271699 missense possibly damaging 0.92
R3946:Cic UTSW 7 25272346 missense possibly damaging 0.93
R4199:Cic UTSW 7 25291670 frame shift probably null
R4426:Cic UTSW 7 25294008 utr 3 prime probably benign
R4502:Cic UTSW 7 25288467 missense probably damaging 1.00
R4585:Cic UTSW 7 25272778 missense probably benign 0.33
R4586:Cic UTSW 7 25272778 missense probably benign 0.33
R4614:Cic UTSW 7 25291670 frame shift probably null
R4664:Cic UTSW 7 25290674 small deletion probably benign
R4688:Cic UTSW 7 25291670 frame shift probably null
R4695:Cic UTSW 7 25273588 missense possibly damaging 0.72
R4696:Cic UTSW 7 25288483 missense probably benign
R4746:Cic UTSW 7 25288480 missense probably damaging 1.00
R4758:Cic UTSW 7 25292211 missense possibly damaging 0.62
R4767:Cic UTSW 7 25271600 missense possibly damaging 0.92
R4776:Cic UTSW 7 25282883 missense possibly damaging 0.95
R4820:Cic UTSW 7 25271732 missense possibly damaging 0.92
R4850:Cic UTSW 7 25272902 missense probably damaging 0.98
R4851:Cic UTSW 7 25272902 missense probably damaging 0.98
R4922:Cic UTSW 7 25291670 small insertion probably benign
R4989:Cic UTSW 7 25287110 missense probably damaging 1.00
R5131:Cic UTSW 7 25291670 small insertion probably benign
R5718:Cic UTSW 7 25272778 missense probably benign 0.33
R5801:Cic UTSW 7 25271438 missense possibly damaging 0.93
R5949:Cic UTSW 7 25272305 missense probably damaging 1.00
R6000:Cic UTSW 7 25271998 missense probably benign 0.33
R6246:Cic UTSW 7 25271642 missense probably damaging 1.00
R6283:Cic UTSW 7 25286034 missense probably damaging 1.00
R6364:Cic UTSW 7 25272823 missense possibly damaging 0.72
R6481:Cic UTSW 7 25288281 missense possibly damaging 0.56
R6919:Cic UTSW 7 25271777 missense probably benign 0.04
R6920:Cic UTSW 7 25290682 missense probably damaging 1.00
R6995:Cic UTSW 7 25271311 missense possibly damaging 0.53
R7002:Cic UTSW 7 25272196 missense probably damaging 0.99
R7113:Cic UTSW 7 25273444 missense probably benign 0.08
R7560:Cic UTSW 7 25272853 missense probably damaging 0.98
R7680:Cic UTSW 7 25292431 missense probably damaging 0.96
R7698:Cic UTSW 7 25273172 missense possibly damaging 0.72
R7746:Cic UTSW 7 25288782 missense probably damaging 1.00
R7879:Cic UTSW 7 25285126 missense probably benign 0.10
R7924:Cic UTSW 7 25285767 missense probably damaging 1.00
R7962:Cic UTSW 7 25285126 missense probably benign 0.10
R8056:Cic UTSW 7 25290941 missense possibly damaging 0.90
V7732:Cic UTSW 7 25292245 missense probably benign
Z1176:Cic UTSW 7 25271019 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GAAGTCCTAACAAGGTGCTTTC -3'
(R):5'- ATTTCCAATCTGGGTGGGCC -3'

Sequencing Primer
(F):5'- GTCCTAACAAGGTGCTTTCTTTATAC -3'
(R):5'- CTTGAAGTGGGCCTCTTTCAC -3'
Posted On2019-12-20