Incidental Mutation 'R7841:Cyp19a1'
ID606311
Institutional Source Beutler Lab
Gene Symbol Cyp19a1
Ensembl Gene ENSMUSG00000032274
Gene Namecytochrome P450, family 19, subfamily a, polypeptide 1
SynonymsCyp19, ArKO, Int-5, aromatase, p450arom, Int5, Ar
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location54165937-54268110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54171805 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 340 (V340E)
Ref Sequence ENSEMBL: ENSMUSP00000034811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034811] [ENSMUST00000215736]
Predicted Effect probably benign
Transcript: ENSMUST00000034811
AA Change: V340E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000034811
Gene: ENSMUSG00000032274
AA Change: V340E

DomainStartEndE-ValueType
low complexity region 28 38 N/A INTRINSIC
Pfam:p450 46 488 1e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215736
AA Change: V273E

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and catalyzes the last steps of estrogen biosynthesis. Mutations in this gene can result in either increased or decreased aromatase activity; the associated phenotypes suggest that estrogen functions both as a sex steroid hormone and in growth or differentiation. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for various mutations that inactivate the gene exhibit defects affecting fertility including impairments of ovulation, spermiogenesis and mounting behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Cyp19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01897:Cyp19a1 APN 9 54168529 missense probably benign 0.03
IGL02885:Cyp19a1 APN 9 54171818 missense probably benign 0.25
IGL02897:Cyp19a1 APN 9 54166911 missense possibly damaging 0.95
R0384:Cyp19a1 UTSW 9 54172741 missense probably benign 0.01
R3104:Cyp19a1 UTSW 9 54186799 missense probably benign 0.00
R4116:Cyp19a1 UTSW 9 54168741 missense possibly damaging 0.94
R4158:Cyp19a1 UTSW 9 54186696 missense probably damaging 1.00
R4160:Cyp19a1 UTSW 9 54186696 missense probably damaging 1.00
R4555:Cyp19a1 UTSW 9 54166821 missense probably damaging 0.96
R4569:Cyp19a1 UTSW 9 54193323 missense probably benign 0.06
R4570:Cyp19a1 UTSW 9 54193323 missense probably benign 0.06
R4693:Cyp19a1 UTSW 9 54173333 missense possibly damaging 0.55
R4807:Cyp19a1 UTSW 9 54176646 missense possibly damaging 0.89
R4853:Cyp19a1 UTSW 9 54166776 missense probably benign
R4938:Cyp19a1 UTSW 9 54173363 missense probably benign 0.01
R5272:Cyp19a1 UTSW 9 54176614 missense probably benign 0.19
R6148:Cyp19a1 UTSW 9 54180256 missense probably damaging 1.00
R7008:Cyp19a1 UTSW 9 54193325 missense probably benign 0.35
R7472:Cyp19a1 UTSW 9 54166993 missense possibly damaging 0.55
R7807:Cyp19a1 UTSW 9 54166842 missense probably benign 0.06
R7924:Cyp19a1 UTSW 9 54171805 missense probably benign 0.03
X0025:Cyp19a1 UTSW 9 54168568 missense probably damaging 1.00
Z1176:Cyp19a1 UTSW 9 54176599 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTTACACATTGCTCTGGTG -3'
(R):5'- CAATTCCTCAGAGACGTGGAGAC -3'

Sequencing Primer
(F):5'- GGTGTTTGGATTCTTCAACAAGCAC -3'
(R):5'- CTCAGAGACGTGGAGACCTGAC -3'
Posted On2019-12-20