Incidental Mutation 'R7841:2810408A11Rik'
ID606323
Institutional Source Beutler Lab
Gene Symbol 2810408A11Rik
Ensembl Gene ENSMUSG00000018570
Gene NameRIKEN cDNA 2810408A11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69897352-69900987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69899286 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 210 (F210L)
Ref Sequence ENSEMBL: ENSMUSP00000099640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000018714] [ENSMUST00000061837] [ENSMUST00000100969] [ENSMUST00000102580] [ENSMUST00000108617] [ENSMUST00000108621] [ENSMUST00000128046] [ENSMUST00000129234] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000144431] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000001631
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000018714
AA Change: F210L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018714
Gene: ENSMUSG00000018570
AA Change: F210L

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061837
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100969
SMART Domains Protein: ENSMUSP00000098529
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 272 5.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102580
AA Change: F210L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099640
Gene: ENSMUSG00000018570
AA Change: F210L

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 153 270 6.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108617
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108621
AA Change: F210L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104261
Gene: ENSMUSG00000018570
AA Change: F210L

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128046
AA Change: F53L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137547
Gene: ENSMUSG00000018570
AA Change: F53L

DomainStartEndE-ValueType
Pfam:IPP-2 1 77 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129234
SMART Domains Protein: ENSMUSP00000136835
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129475
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000133203
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144431
SMART Domains Protein: ENSMUSP00000135926
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177138
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177476
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in 2810408A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0180:2810408A11Rik UTSW 11 69898876 missense probably benign 0.37
R1774:2810408A11Rik UTSW 11 69900627 missense probably damaging 0.98
R2034:2810408A11Rik UTSW 11 69900559 missense probably benign 0.00
R2085:2810408A11Rik UTSW 11 69900372 missense possibly damaging 0.92
R3016:2810408A11Rik UTSW 11 69899222 missense probably benign 0.00
R4580:2810408A11Rik UTSW 11 69900411 missense probably damaging 1.00
R4831:2810408A11Rik UTSW 11 69900577 missense possibly damaging 0.46
R5868:2810408A11Rik UTSW 11 69897575 missense possibly damaging 0.92
R6129:2810408A11Rik UTSW 11 69898311 missense probably damaging 1.00
R7924:2810408A11Rik UTSW 11 69899286 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGTGCTTGTCAAAATCACTGG -3'
(R):5'- CTTTGAAGGCAGTCTCAGATAGC -3'

Sequencing Primer
(F):5'- GCTTGTCAAAATCACTGGAGTCTG -3'
(R):5'- AAGGCAGTCTCAGATAGCTTTGTTC -3'
Posted On2019-12-20