Incidental Mutation 'R7841:Ccnh'
ID606328
Institutional Source Beutler Lab
Gene Symbol Ccnh
Ensembl Gene ENSMUSG00000021548
Gene Namecyclin H
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location85189408-85223469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85189593 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 20 (A20T)
Ref Sequence ENSEMBL: ENSMUSP00000131136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022030] [ENSMUST00000163600] [ENSMUST00000164127] [ENSMUST00000165077]
Predicted Effect probably benign
Transcript: ENSMUST00000022030
AA Change: A20T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022030
Gene: ENSMUSG00000021548
AA Change: A20T

DomainStartEndE-ValueType
CYCLIN 62 152 2.1e-13 SMART
SCOP:d1jkw_2 162 287 8e-47 SMART
Blast:CYCLIN 169 237 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163600
AA Change: A20T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129349
Gene: ENSMUSG00000021548
AA Change: A20T

DomainStartEndE-ValueType
CYCLIN 62 152 2.1e-13 SMART
SCOP:d1jkw_2 162 251 4e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164127
AA Change: A20T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131136
Gene: ENSMUSG00000021548
AA Change: A20T

DomainStartEndE-ValueType
CYCLIN 62 152 2.1e-13 SMART
Pfam:Cyclin_C_2 162 262 3.6e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165077
AA Change: A20T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130839
Gene: ENSMUSG00000021548
AA Change: A20T

DomainStartEndE-ValueType
PDB:1JKW|A 1 111 1e-72 PDB
SCOP:d1jkw_1 11 104 1e-18 SMART
Blast:CYCLIN 62 111 5e-25 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with CDK7 kinase and ring finger protein MAT1. The kinase complex is able to phosphorylate CDK2 and CDC2 kinases, thus functions as a CDK-activating kinase (CAK). This cyclin and its kinase partner are components of TFIIH, as well as RNA polymerase II protein complexes. They participate in two different transcriptional regulation processes, suggesting an important link between basal transcription control and the cell cycle machinery. A pseudogene of this gene is found on chromosome 4. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Ccnh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Ccnh APN 13 85206151 missense probably damaging 1.00
IGL02544:Ccnh APN 13 85202341 nonsense probably null
IGL02547:Ccnh APN 13 85202504 unclassified probably benign
IGL03167:Ccnh APN 13 85197566 splice site probably benign
R0121:Ccnh UTSW 13 85206193 missense probably damaging 1.00
R1781:Ccnh UTSW 13 85206135 missense possibly damaging 0.59
R3775:Ccnh UTSW 13 85206124 unclassified probably benign
R4748:Ccnh UTSW 13 85189639 missense probably benign 0.41
R4905:Ccnh UTSW 13 85206135 missense possibly damaging 0.59
R5696:Ccnh UTSW 13 85196327 critical splice donor site probably null
R5976:Ccnh UTSW 13 85190863 missense probably damaging 1.00
R6784:Ccnh UTSW 13 85212765 missense probably benign
R7871:Ccnh UTSW 13 85211872 nonsense probably null
R7924:Ccnh UTSW 13 85189593 missense probably benign 0.00
R7954:Ccnh UTSW 13 85211872 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGTTCTTTGTGCCCAGGC -3'
(R):5'- AAGTCCGCACTCTTCCAAG -3'

Sequencing Primer
(F):5'- TCTGGAACCTGGATCCCTG -3'
(R):5'- AGTCCCCAGGATGTCACTCAG -3'
Posted On2019-12-20