Incidental Mutation 'R0082:Lrrc46'
ID60633
Institutional Source Beutler Lab
Gene Symbol Lrrc46
Ensembl Gene ENSMUSG00000020878
Gene Nameleucine rich repeat containing 46
Synonyms
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0082 (G1)
Quality Score149
Status Validated
Chromosome11
Chromosomal Location97034602-97041407 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 97041077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001485] [ENSMUST00000021251] [ENSMUST00000054252]
Predicted Effect probably benign
Transcript: ENSMUST00000001485
SMART Domains Protein: ENSMUSP00000001485
Gene: ENSMUSG00000001445

DomainStartEndE-ValueType
low complexity region 66 73 N/A INTRINSIC
low complexity region 109 120 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021251
SMART Domains Protein: ENSMUSP00000021251
Gene: ENSMUSG00000020878

DomainStartEndE-ValueType
SCOP:d1h6ua2 44 150 1e-15 SMART
Blast:LRR 69 91 7e-6 BLAST
low complexity region 179 191 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 265 292 N/A INTRINSIC
low complexity region 297 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054252
SMART Domains Protein: ENSMUSP00000103244
Gene: ENSMUSG00000001445

DomainStartEndE-ValueType
low complexity region 66 73 N/A INTRINSIC
low complexity region 109 120 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120287
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Lrrc46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Lrrc46 APN 11 97035875 missense probably damaging 1.00
IGL01933:Lrrc46 APN 11 97035528 missense probably benign 0.21
R0054:Lrrc46 UTSW 11 97038779 missense probably damaging 1.00
R0054:Lrrc46 UTSW 11 97038779 missense probably damaging 1.00
R1104:Lrrc46 UTSW 11 97036171 missense probably damaging 1.00
R1756:Lrrc46 UTSW 11 97034730 unclassified probably benign
R2394:Lrrc46 UTSW 11 97038831 missense probably damaging 1.00
R2885:Lrrc46 UTSW 11 97034980 missense probably damaging 1.00
R2932:Lrrc46 UTSW 11 97041109 unclassified probably benign
R4361:Lrrc46 UTSW 11 97034670 unclassified probably benign
R4678:Lrrc46 UTSW 11 97034893 missense probably benign 0.37
R4989:Lrrc46 UTSW 11 97040939 missense probably damaging 1.00
R5150:Lrrc46 UTSW 11 97036131 missense probably damaging 1.00
R6390:Lrrc46 UTSW 11 97040931 missense probably damaging 1.00
R6467:Lrrc46 UTSW 11 97036479 missense possibly damaging 0.93
R6860:Lrrc46 UTSW 11 97035545 missense probably benign 0.05
R7373:Lrrc46 UTSW 11 97038880 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCATCTCCAGGGAAGGTCAGGTTC -3'
(R):5'- AGTTTAAGGCCAGTAAAGCCACGC -3'

Sequencing Primer
(F):5'- CCGCTTGGTGATAAGGGC -3'
(R):5'- ACCTCTAACTCCAGATCCTTCG -3'
Posted On2013-07-24