Incidental Mutation 'R7841:Synj2'
ID606338
Institutional Source Beutler Lab
Gene Symbol Synj2
Ensembl Gene ENSMUSG00000023805
Gene Namesynaptojanin 2
SynonymsSJ2
Accession Numbers

Genbank: NM_001113353.1, NM_001113352.1, NM_011523.2, NM_001113351.1

Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location5941280-6044290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 6044144 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1215 (R1215H)
Ref Sequence ENSEMBL: ENSMUSP00000060382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024570] [ENSMUST00000061091] [ENSMUST00000097432] [ENSMUST00000115791] [ENSMUST00000134767]
Predicted Effect silent
Transcript: ENSMUST00000024570
SMART Domains Protein: ENSMUSP00000024570
Gene: ENSMUSG00000015659

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
SCOP:d1jdha_ 243 336 3e-5 SMART
Pfam:PGAP1 360 519 3.4e-9 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000061091
AA Change: R1215H
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805
AA Change: R1215H

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000097432
SMART Domains Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
SCOP:d1gw5a_ 89 464 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115791
SMART Domains Protein: ENSMUSP00000111457
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 61 343 8.5e-67 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1262 1279 N/A INTRINSIC
low complexity region 1308 1322 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134767
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss and cochlear hair cell degeneration associated with fusion of stereocilia followed by total loss of hair bundles and cochlear ganglion degeneration. No vestibular dysfunction or other behavioral deficits are observed. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Synj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Synj2 APN 17 6037926 missense possibly damaging 0.48
IGL01399:Synj2 APN 17 6009771 missense probably damaging 1.00
IGL01793:Synj2 APN 17 6027225 nonsense probably null
IGL01793:Synj2 APN 17 6038046 missense probably benign 0.01
IGL02096:Synj2 APN 17 5990353 missense probably damaging 1.00
IGL02115:Synj2 APN 17 6017590 missense probably damaging 1.00
IGL02222:Synj2 APN 17 6037480 missense probably benign 0.04
IGL02478:Synj2 APN 17 6037924 missense probably benign 0.00
IGL02634:Synj2 APN 17 6029760 missense probably damaging 1.00
IGL02652:Synj2 APN 17 6017593 missense probably damaging 1.00
IGL02681:Synj2 APN 17 5990336 missense probably damaging 1.00
IGL02719:Synj2 APN 17 5996917 missense probably benign 0.02
IGL03253:Synj2 APN 17 6003159 unclassified probably null
IGL03365:Synj2 APN 17 6019404 missense probably damaging 1.00
I2288:Synj2 UTSW 17 6022267 splice site probably benign
I2289:Synj2 UTSW 17 6022267 splice site probably benign
R0389:Synj2 UTSW 17 6029783 missense probably benign 0.35
R0433:Synj2 UTSW 17 6033848 missense probably damaging 1.00
R0530:Synj2 UTSW 17 6008105 missense possibly damaging 0.88
R0539:Synj2 UTSW 17 5996888 start codon destroyed probably null 0.63
R0556:Synj2 UTSW 17 6037955 nonsense probably null
R1263:Synj2 UTSW 17 6019359 missense probably damaging 0.99
R1443:Synj2 UTSW 17 6023665 missense probably damaging 0.99
R1450:Synj2 UTSW 17 6027324 splice site probably benign
R1532:Synj2 UTSW 17 6033919 missense probably benign 0.00
R1542:Synj2 UTSW 17 6025017 missense probably benign 0.01
R1809:Synj2 UTSW 17 6026551 missense possibly damaging 0.95
R1875:Synj2 UTSW 17 6028550 missense possibly damaging 0.69
R1897:Synj2 UTSW 17 6022137 nonsense probably null
R1928:Synj2 UTSW 17 5990267 missense probably damaging 0.99
R2008:Synj2 UTSW 17 5996946 missense probably damaging 1.00
R2060:Synj2 UTSW 17 6037480 missense probably benign 0.04
R2109:Synj2 UTSW 17 6013691 missense probably benign 0.00
R2332:Synj2 UTSW 17 6023794 missense probably damaging 0.99
R2413:Synj2 UTSW 17 6028574 missense probably damaging 1.00
R3684:Synj2 UTSW 17 6028443 missense probably damaging 0.97
R4111:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4113:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4654:Synj2 UTSW 17 6013538 missense probably damaging 1.00
R4797:Synj2 UTSW 17 6033888 missense probably damaging 1.00
R4812:Synj2 UTSW 17 6010664 missense probably damaging 1.00
R4873:Synj2 UTSW 17 5988068 intron probably benign
R4875:Synj2 UTSW 17 5988068 intron probably benign
R5110:Synj2 UTSW 17 6037715 missense probably benign 0.06
R5205:Synj2 UTSW 17 5941518 missense probably damaging 1.00
R5504:Synj2 UTSW 17 6036475 missense possibly damaging 0.85
R5593:Synj2 UTSW 17 6038115 makesense probably null
R5690:Synj2 UTSW 17 6035527 missense probably benign 0.00
R5870:Synj2 UTSW 17 6037853 missense probably benign 0.00
R6084:Synj2 UTSW 17 6017614 missense probably damaging 0.98
R6084:Synj2 UTSW 17 6038098 missense probably damaging 1.00
R6158:Synj2 UTSW 17 5986212 missense probably benign 0.00
R6159:Synj2 UTSW 17 5986052 missense probably damaging 1.00
R6160:Synj2 UTSW 17 6008061 missense possibly damaging 0.92
R6278:Synj2 UTSW 17 5975874 missense probably damaging 1.00
R6406:Synj2 UTSW 17 6019571 intron probably benign
R6531:Synj2 UTSW 17 6033839 missense probably damaging 1.00
R6729:Synj2 UTSW 17 5986014 start codon destroyed probably null 1.00
R6774:Synj2 UTSW 17 6038015 missense possibly damaging 0.87
R6792:Synj2 UTSW 17 5990290 missense probably benign 0.01
R6844:Synj2 UTSW 17 5975806 missense probably damaging 0.96
R6865:Synj2 UTSW 17 6017569 nonsense probably null
R7178:Synj2 UTSW 17 6026479 missense possibly damaging 0.95
R7286:Synj2 UTSW 17 6037945 missense possibly damaging 0.79
R7403:Synj2 UTSW 17 6037730 missense possibly damaging 0.76
R7451:Synj2 UTSW 17 6029791 missense possibly damaging 0.68
R7501:Synj2 UTSW 17 5990239 missense possibly damaging 0.79
R7730:Synj2 UTSW 17 6016287 missense probably benign 0.33
R7799:Synj2 UTSW 17 6037823 missense probably benign 0.10
R7804:Synj2 UTSW 17 6019534 missense unknown
R7924:Synj2 UTSW 17 6044144 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTAAGCCTTCCTCTGTGGC -3'
(R):5'- TTTCACACAGGGAGTCAGAGTTC -3'

Sequencing Primer
(F):5'- AGGTGTACTCGGGCATCTC -3'
(R):5'- GTCAGAGTTCTGCTAGGCAAG -3'
Posted On2019-12-20