Incidental Mutation 'R7841:Tbc1d5'
ID606341
Institutional Source Beutler Lab
Gene Symbol Tbc1d5
Ensembl Gene ENSMUSG00000023923
Gene NameTBC1 domain family, member 5
Synonyms1600014N05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7841 (G1)
Quality Score217.468
Status Not validated
Chromosome17
Chromosomal Location50733124-51179352 bp(-) (GRCm38)
Type of Mutationsmall deletion (7 aa in frame mutation)
DNA Base Change (assembly) TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG to TTGCTGCTG at 50799922 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024717] [ENSMUST00000224528]
Predicted Effect probably benign
Transcript: ENSMUST00000024717
SMART Domains Protein: ENSMUSP00000024717
Gene: ENSMUSG00000023923

DomainStartEndE-ValueType
TBC 78 384 5.56e-86 SMART
low complexity region 475 492 N/A INTRINSIC
SCOP:d1lsha3 511 546 1e-3 SMART
low complexity region 556 568 N/A INTRINSIC
low complexity region 783 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224528
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxl17 T C 17: 63,487,825 R421G probably damaging Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Tbc1d5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tbc1d5 APN 17 50813798 missense possibly damaging 0.52
IGL01370:Tbc1d5 APN 17 50966727 missense probably benign 0.18
IGL01625:Tbc1d5 APN 17 50917573 missense probably benign 0.27
IGL01935:Tbc1d5 APN 17 50963765 splice site probably benign
IGL02229:Tbc1d5 APN 17 50852600 missense probably damaging 1.00
IGL02811:Tbc1d5 APN 17 50800121 missense probably damaging 0.99
IGL03192:Tbc1d5 APN 17 50984681 splice site probably benign
FR4976:Tbc1d5 UTSW 17 50799931 missense probably benign
FR4976:Tbc1d5 UTSW 17 50799943 missense probably benign 0.01
IGL02796:Tbc1d5 UTSW 17 50966624 missense probably damaging 1.00
R0153:Tbc1d5 UTSW 17 50984687 splice site probably benign
R0326:Tbc1d5 UTSW 17 50966736 missense probably damaging 1.00
R0417:Tbc1d5 UTSW 17 50756705 missense probably benign 0.18
R0481:Tbc1d5 UTSW 17 50919051 missense probably damaging 0.98
R1143:Tbc1d5 UTSW 17 50742059 nonsense probably null
R1533:Tbc1d5 UTSW 17 50920575 missense possibly damaging 0.89
R1543:Tbc1d5 UTSW 17 50935532 missense probably benign 0.32
R2888:Tbc1d5 UTSW 17 50935549 missense probably damaging 1.00
R3153:Tbc1d5 UTSW 17 50968236 missense probably damaging 1.00
R3430:Tbc1d5 UTSW 17 50800128 missense probably damaging 1.00
R3898:Tbc1d5 UTSW 17 50963744 missense probably damaging 0.98
R4116:Tbc1d5 UTSW 17 50920587 missense probably damaging 1.00
R4352:Tbc1d5 UTSW 17 50782401 missense probably damaging 0.98
R4456:Tbc1d5 UTSW 17 50782341 missense probably damaging 1.00
R4648:Tbc1d5 UTSW 17 50736223 missense probably benign
R4711:Tbc1d5 UTSW 17 50935509 missense probably damaging 0.98
R4754:Tbc1d5 UTSW 17 50800165 missense probably benign 0.03
R5303:Tbc1d5 UTSW 17 50736200 missense probably benign 0.00
R5360:Tbc1d5 UTSW 17 50984632 missense probably benign 0.26
R5443:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5444:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5611:Tbc1d5 UTSW 17 50735967 missense probably damaging 0.98
R5658:Tbc1d5 UTSW 17 50813841 missense probably benign 0.18
R5701:Tbc1d5 UTSW 17 50799955 small deletion probably benign
R5921:Tbc1d5 UTSW 17 50963693 missense probably damaging 1.00
R6280:Tbc1d5 UTSW 17 50782310 missense probably benign 0.01
R6628:Tbc1d5 UTSW 17 50736208 missense probably benign
R6705:Tbc1d5 UTSW 17 51025175 start gained probably benign
R6990:Tbc1d5 UTSW 17 50968232 missense probably benign 0.19
R7184:Tbc1d5 UTSW 17 50800082 missense probably benign 0.00
R7443:Tbc1d5 UTSW 17 50966735 missense probably damaging 1.00
R7484:Tbc1d5 UTSW 17 50917545 missense possibly damaging 0.68
R7696:Tbc1d5 UTSW 17 50874577 missense probably damaging 1.00
R7787:Tbc1d5 UTSW 17 50874683 nonsense probably null
R7827:Tbc1d5 UTSW 17 50782263 missense probably damaging 0.99
R7861:Tbc1d5 UTSW 17 50756692 missense probably damaging 0.99
R7924:Tbc1d5 UTSW 17 50799922 small deletion probably benign
R7944:Tbc1d5 UTSW 17 50756692 missense probably damaging 0.99
Z1088:Tbc1d5 UTSW 17 50963696 missense probably damaging 1.00
Z1177:Tbc1d5 UTSW 17 50966553 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAAGAATACGTTGTCAAATACC -3'
(R):5'- AGGTCTCCAACAGCTTGATTAAC -3'

Sequencing Primer
(F):5'- GAGGAACACCATATCAAATCTCTAGC -3'
(R):5'- GTCTCCAACAGCTTGATTAACTTTGG -3'
Posted On2019-12-20