Incidental Mutation 'R7841:Fbxl17'
ID606342
Institutional Source Beutler Lab
Gene Symbol Fbxl17
Ensembl Gene ENSMUSG00000023965
Gene NameF-box and leucine-rich repeat protein 17
Synonyms6330576B01Rik, Fbxo13, Fbx13, C130023C01Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.425) question?
Stock #R7841 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location63057452-63500017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63487825 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 421 (R421G)
Ref Sequence ENSEMBL: ENSMUSP00000024761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024761] [ENSMUST00000112840]
Predicted Effect probably damaging
Transcript: ENSMUST00000024761
AA Change: R421G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024761
Gene: ENSMUSG00000023965
AA Change: R421G

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
low complexity region 103 138 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
low complexity region 214 245 N/A INTRINSIC
low complexity region 246 270 N/A INTRINSIC
FBOX 324 365 3.1e-8 SMART
LRR 359 384 4.6e-1 SMART
LRR 385 410 2e-1 SMART
LRR 411 436 8.5e-2 SMART
LRR 437 462 6.9e-4 SMART
LRR 463 488 1.3e-5 SMART
LRR 489 514 5.2e-2 SMART
LRR 515 539 2.9e-3 SMART
LRR 540 564 2e-1 SMART
low complexity region 567 580 N/A INTRINSIC
LRR 591 615 8.4e-4 SMART
LRR 616 641 2.2e-1 SMART
LRR 642 667 6.3e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112840
SMART Domains Protein: ENSMUSP00000108459
Gene: ENSMUSG00000023965

DomainStartEndE-ValueType
LRR 8 33 1.2e1 SMART
LRR 34 58 6.57e-1 SMART
LRR 59 83 4.67e1 SMART
low complexity region 86 99 N/A INTRINSIC
LRR 110 134 1.89e-1 SMART
LRR 135 160 5.25e1 SMART
LRR 161 186 1.47e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL17, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016H13Rik T C 5: 103,654,940 K16R possibly damaging Het
2810408A11Rik A G 11: 69,899,286 F210L probably benign Het
A930017K11Rik A T 17: 25,948,484 Y26* probably null Het
Adam6a G T 12: 113,545,458 D484Y probably damaging Het
AU019823 A C 9: 50,610,416 S68R probably damaging Het
B9d1 A G 11: 61,506,366 Y29C possibly damaging Het
Cald1 T C 6: 34,745,761 F115L unknown Het
Ccnd1 A T 7: 144,937,981 M107K probably damaging Het
Ccnh G A 13: 85,189,593 A20T probably benign Het
Cep162 T C 9: 87,244,316 D181G probably benign Het
Cep44 AACGC A 8: 56,540,983 probably null Het
Ces2b A G 8: 104,835,060 D262G probably benign Het
Cic A G 7: 25,285,767 Y1146C probably damaging Het
Cmtm1 G A 8: 104,309,476 R174C possibly damaging Het
Cobl G T 11: 12,253,324 P1126H probably damaging Het
Col14a1 T A 15: 55,382,480 M460K unknown Het
Cst11 G A 2: 148,771,307 R33W possibly damaging Het
Cyp19a1 A T 9: 54,171,805 V340E probably benign Het
Dbt A T 3: 116,546,097 Q378L possibly damaging Het
Dchs1 A G 7: 105,762,973 V1312A probably benign Het
Eif3l T C 15: 79,089,579 M398T probably benign Het
Faxc A G 4: 21,958,584 H247R probably benign Het
Fbxo3 T A 2: 104,059,992 D450E unknown Het
Fmn1 T C 2: 113,529,465 probably null Het
Foxs1 T A 2: 152,932,987 M49L possibly damaging Het
Gucy1a2 A G 9: 3,634,766 E270G probably benign Het
Helz2 T C 2: 181,232,902 D1933G probably damaging Het
Hspa4 G A 11: 53,267,060 A572V possibly damaging Het
Ica1 T A 6: 8,737,072 D174V probably damaging Het
Igfbp6 A T 15: 102,147,917 Q137L possibly damaging Het
Il1r2 T C 1: 40,105,468 L105P probably damaging Het
Iqca A T 1: 90,059,615 C72S Het
Itgbl1 T C 14: 123,972,233 probably null Het
Ivl T A 3: 92,572,392 Q122L possibly damaging Het
Kdsr T C 1: 106,743,685 E198G probably damaging Het
Lama2 T C 10: 27,155,533 T1510A probably benign Het
Lrrc37a A T 11: 103,501,105 Y1165N probably benign Het
Mycbp2 A G 14: 103,146,831 probably null Het
Myh3 A G 11: 67,098,692 E1546G probably damaging Het
Nacad A T 11: 6,601,031 V720E probably benign Het
Napa A G 7: 16,115,634 D257G possibly damaging Het
Nif3l1 T C 1: 58,447,883 V76A probably damaging Het
Nphp4 G A 4: 152,496,683 S108N probably benign Het
Npr1 A T 3: 90,454,868 L990H probably damaging Het
Nup205 A G 6: 35,247,437 R322G unknown Het
Olfr1252 C A 2: 89,721,965 A49S probably benign Het
Olfr668 T A 7: 104,924,859 I302F possibly damaging Het
Olfr735 G T 14: 50,345,828 Q174K probably benign Het
Olfr892-ps1 T G 9: 38,190,481 M252R unknown Het
Olfr897-ps1 T A 9: 38,309,521 V242E unknown Het
Ovch2 G T 7: 107,794,091 Q192K probably benign Het
Pcca T A 14: 122,562,972 D91E probably benign Het
Pole2 T C 12: 69,204,258 T444A probably damaging Het
Ppip5k1 T C 2: 121,342,795 K466E probably benign Het
Ptgfrn A T 3: 101,060,810 I489N probably damaging Het
Rassf1 A G 9: 107,561,545 *341W probably null Het
Ret G A 6: 118,155,360 P1040S probably damaging Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rsf1 A AAGGCGACGG 7: 97,579,904 probably null Het
Slc6a17 A T 3: 107,476,898 Y377N possibly damaging Het
Snrnp200 C A 2: 127,236,834 D1806E probably benign Het
Synj2 G A 17: 6,044,144 R1215H unknown Het
Tbc1d5 TTGCTGCTGGTGTTGCTGCTGCTGCTGCTG TTGCTGCTG 17: 50,799,922 probably benign Het
Top2a A T 11: 99,022,350 D85E probably damaging Het
Tram1l1 A T 3: 124,321,704 Q171L probably damaging Het
Tram1l1 G T 3: 124,321,705 Q171H probably damaging Het
Tspyl4 A G 10: 34,298,271 H253R probably damaging Het
Ttn T C 2: 76,832,146 I23V Het
Ubr5 T C 15: 37,980,906 N2376D Het
Ugt2b37 T C 5: 87,250,630 N316D probably benign Het
Usp31 A C 7: 121,648,456 S1255A probably benign Het
Usp31 A T 7: 121,677,312 V334E probably damaging Het
Vmn2r108 A G 17: 20,470,043 probably null Het
Vmn2r87 T A 10: 130,497,226 T52S probably benign Het
Vrk2 C A 11: 26,471,457 L500F probably damaging Het
Zan T A 5: 137,436,802 I2110F unknown Het
Other mutations in Fbxl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Fbxl17 APN 17 63385052 missense probably damaging 1.00
IGL02201:Fbxl17 APN 17 63499029 missense probably damaging 1.00
IGL02256:Fbxl17 APN 17 63499090 missense probably benign
IGL03408:Fbxl17 APN 17 63080546 nonsense probably null
R0268:Fbxl17 UTSW 17 63385067 splice site probably benign
R0269:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0313:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0315:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0344:Fbxl17 UTSW 17 63385067 splice site probably benign
R0356:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0358:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0553:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0617:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0629:Fbxl17 UTSW 17 63471414 missense probably damaging 1.00
R1597:Fbxl17 UTSW 17 63487818 missense probably damaging 1.00
R1666:Fbxl17 UTSW 17 63385065 splice site probably null
R3001:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3002:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3121:Fbxl17 UTSW 17 63471424 missense probably damaging 0.96
R3909:Fbxl17 UTSW 17 63499807 missense possibly damaging 0.93
R4789:Fbxl17 UTSW 17 63487915 missense probably benign 0.40
R6606:Fbxl17 UTSW 17 63487788 missense probably damaging 0.97
R7153:Fbxl17 UTSW 17 63060351 missense probably benign 0.09
R7722:Fbxl17 UTSW 17 63356828 missense probably damaging 0.99
R7794:Fbxl17 UTSW 17 63356811 missense probably damaging 0.97
R7924:Fbxl17 UTSW 17 63487825 missense probably damaging 1.00
X0019:Fbxl17 UTSW 17 63060383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGTGACAGTTCTTTAATCAGTG -3'
(R):5'- ACTCTGACACTCGGAAGGTTC -3'

Sequencing Primer
(F):5'- TGTGTGAAATCTCTCAGAAAAGGCC -3'
(R):5'- ATAGTTTTCCACTTCCAGCAAAG -3'
Posted On2019-12-20