Incidental Mutation 'R7842:Map2'
ID606343
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.729) question?
Stock #R7842 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66416411 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1421 (D1421E)
Ref Sequence ENSEMBL: ENSMUSP00000109646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000145419] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800] [ENSMUST00000173855]
Predicted Effect probably benign
Transcript: ENSMUST00000024639
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077355
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114012
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114013
AA Change: D1421E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: D1421E

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114015
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114017
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114018
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141148
SMART Domains Protein: ENSMUSP00000117996
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:RII_binding_1 23 40 3.2e-6 PFAM
low complexity region 70 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145419
SMART Domains Protein: ENSMUSP00000134538
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 218 608 1.7e-250 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172886
AA Change: D35E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222
AA Change: D35E

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173778
AA Change: D35E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222
AA Change: D35E

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173855
SMART Domains Protein: ENSMUSP00000134471
Gene: ENSMUSG00000015222

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 142 163 N/A INTRINSIC
Pfam:MAP2_projctn 458 565 1.1e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Abca6 A G 11: 110,196,697 L1135P possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 N532I probably benign Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Klhdc7a A G 4: 139,967,238 S133P probably damaging Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Mxra8 A G 4: 155,842,910 D384G probably damaging Het
Myo15b A G 11: 115,871,495 T1214A Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nsmaf T A 4: 6,435,109 probably null Het
Nynrin A G 14: 55,865,096 R741G probably damaging Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
costas UTSW 1 66412653 missense possibly damaging 0.94
Jacobin UTSW 1 66399419 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
Rufous UTSW 1 66380768 missense probably damaging 1.00
Speckled UTSW 1 66412727 nonsense probably null
Sunbird UTSW 1 66415487 missense probably benign 0.01
E0370:Map2 UTSW 1 66416724 unclassified probably benign
PIT4362001:Map2 UTSW 1 66412518 missense probably benign 0.05
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 unclassified probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4613:Map2 UTSW 1 66425469 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
R7001:Map2 UTSW 1 66415487 missense probably benign 0.01
R7055:Map2 UTSW 1 66416824 missense probably damaging 1.00
R7094:Map2 UTSW 1 66412727 nonsense probably null
R7106:Map2 UTSW 1 66410744 missense possibly damaging 0.92
R7182:Map2 UTSW 1 66412653 missense possibly damaging 0.94
R7235:Map2 UTSW 1 66414648 missense probably damaging 1.00
R7424:Map2 UTSW 1 66414824 missense possibly damaging 0.69
R7473:Map2 UTSW 1 66415458 missense probably damaging 1.00
R7642:Map2 UTSW 1 66413307 missense probably benign 0.01
R7660:Map2 UTSW 1 66414377 missense probably damaging 1.00
R7673:Map2 UTSW 1 66413774 missense probably benign 0.03
R7768:Map2 UTSW 1 66414483 missense possibly damaging 0.94
R7834:Map2 UTSW 1 66416488 missense probably damaging 1.00
R7917:Map2 UTSW 1 66416488 missense probably damaging 1.00
R7925:Map2 UTSW 1 66416411 missense probably benign
R8056:Map2 UTSW 1 66415620 missense probably damaging 0.99
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Z1177:Map2 UTSW 1 66380680 missense probably benign 0.01
Z1177:Map2 UTSW 1 66438361 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGTAGCCTAGTGGGGAATTTG -3'
(R):5'- CAAGTTGCTTTGTCAAAAGAGC -3'

Sequencing Primer
(F):5'- GGGGAATTTGGTTTTCACTTTAAAC -3'
(R):5'- GTTGCTTTGTCAAAAGAGCAATAAC -3'
Posted On2019-12-20