Incidental Mutation 'R0082:Srek1'
ID60635
Institutional Source Beutler Lab
Gene Symbol Srek1
Ensembl Gene ENSMUSG00000032621
Gene Namesplicing regulatory glutamine/lysine-rich protein 1
SynonymsSRrp508, Sfrs12, SRrp86
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R0082 (G1)
Quality Score204
Status Validated
Chromosome13
Chromosomal Location103739348-103774608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103743686 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 455 (T455A)
Ref Sequence ENSEMBL: ENSMUSP00000147737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074616] [ENSMUST00000210489]
Predicted Effect unknown
Transcript: ENSMUST00000074616
AA Change: T571A
SMART Domains Protein: ENSMUSP00000074196
Gene: ENSMUSG00000032621
AA Change: T571A

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
RRM 70 141 1.22e-18 SMART
coiled coil region 259 298 N/A INTRINSIC
low complexity region 356 395 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 414 427 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210269
Predicted Effect unknown
Transcript: ENSMUST00000210489
AA Change: T455A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211491
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik T C 9: 51,101,802 T57A probably benign Het
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in Srek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Srek1 APN 13 103760582 missense probably damaging 1.00
IGL01834:Srek1 APN 13 103748785 unclassified probably benign
IGL03029:Srek1 APN 13 103763960 utr 5 prime probably benign
IGL03198:Srek1 APN 13 103744935 splice site probably null
IGL03284:Srek1 APN 13 103760537 missense probably damaging 0.96
inscruitable UTSW 13 103774386 missense probably damaging 1.00
PIT4453001:Srek1 UTSW 13 103744783 critical splice donor site probably null
R0080:Srek1 UTSW 13 103743686 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0506:Srek1 UTSW 13 103760590 missense probably damaging 0.99
R0569:Srek1 UTSW 13 103748862 unclassified probably benign
R0969:Srek1 UTSW 13 103752503 unclassified probably benign
R1617:Srek1 UTSW 13 103743604 missense unknown
R2098:Srek1 UTSW 13 103744855 missense unknown
R2423:Srek1 UTSW 13 103753028 nonsense probably null
R3950:Srek1 UTSW 13 103744895 missense unknown
R4347:Srek1 UTSW 13 103748759 missense probably null
R4676:Srek1 UTSW 13 103758187 splice site probably benign
R4915:Srek1 UTSW 13 103752563 unclassified probably benign
R4915:Srek1 UTSW 13 103752686 utr 3 prime probably benign
R5119:Srek1 UTSW 13 103752556 unclassified probably benign
R5677:Srek1 UTSW 13 103759244 missense probably damaging 0.98
R6135:Srek1 UTSW 13 103774386 missense probably damaging 1.00
R6458:Srek1 UTSW 13 103743568 missense probably benign 0.01
R7406:Srek1 UTSW 13 103769382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGCTTTGGGTTTGATCCCGC -3'
(R):5'- GGGCAGAATTTGGACTGCTTTTCAC -3'

Sequencing Primer
(F):5'- TTTGATCCCGCCGTGGAG -3'
(R):5'- tcagaaatccgcctgcc -3'
Posted On2013-07-24