Incidental Mutation 'R7842:Nsmaf'
ID606359
Institutional Source Beutler Lab
Gene Symbol Nsmaf
Ensembl Gene ENSMUSG00000028245
Gene Nameneutral sphingomyelinase (N-SMase) activation associated factor
SynonymsFan, factor associated with N-SMase activation
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R7842 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location6396207-6454271 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 6435109 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000124344]
Predicted Effect probably null
Transcript: ENSMUST00000029910
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124344
SMART Domains Protein: ENSMUSP00000120980
Gene: ENSMUSG00000028245

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD-repeat protein that binds the cytoplasmic sphingomyelinase activation domain of the 55kD tumor necrosis factor receptor. This protein is required for TNF-mediated activation of neutral sphingomyelinase and may play a role in regulating TNF-induced cellular responses such as inflammation. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation show no gross phenotypic abnormalities but display delayed cutaneous barrier repair. In addition, D-galactosamine-sensitized homozygotes are partially resistant to LPS- and TNF-induced lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Abca6 A G 11: 110,196,697 L1135P possibly damaging Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 N532I probably benign Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Dusp22 T A 13: 30,668,791 probably null Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Gucy2c C T 6: 136,769,816 probably null Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Klhdc7a A G 4: 139,967,238 S133P probably damaging Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map2 T A 1: 66,416,411 D1421E probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Mxra8 A G 4: 155,842,910 D384G probably damaging Het
Myo15b A G 11: 115,871,495 T1214A Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nynrin A G 14: 55,865,096 R741G probably damaging Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Qrich1 T A 9: 108,556,368 probably null Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Ube4a A G 9: 44,949,727 probably null Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Other mutations in Nsmaf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:Nsmaf APN 4 6417163 critical splice donor site probably null
IGL00778:Nsmaf APN 4 6435056 critical splice donor site probably null
IGL01775:Nsmaf APN 4 6396791 missense possibly damaging 0.79
IGL02003:Nsmaf APN 4 6418522 missense probably benign 0.02
IGL02039:Nsmaf APN 4 6424995 splice site probably benign
IGL02085:Nsmaf APN 4 6398551 missense probably benign 0.21
IGL02252:Nsmaf APN 4 6398378 missense probably benign 0.00
IGL02655:Nsmaf APN 4 6424933 missense possibly damaging 0.94
R0023:Nsmaf UTSW 4 6408680 missense probably damaging 0.96
R0454:Nsmaf UTSW 4 6424874 splice site probably null
R0538:Nsmaf UTSW 4 6419930 splice site probably null
R0605:Nsmaf UTSW 4 6418470 critical splice donor site probably null
R1033:Nsmaf UTSW 4 6438054 missense probably damaging 1.00
R1472:Nsmaf UTSW 4 6423448 nonsense probably null
R1519:Nsmaf UTSW 4 6438062 missense probably benign 0.06
R1641:Nsmaf UTSW 4 6409884 missense probably benign 0.01
R1668:Nsmaf UTSW 4 6398880 missense probably damaging 0.98
R2212:Nsmaf UTSW 4 6396732 missense probably damaging 0.99
R2351:Nsmaf UTSW 4 6437921 missense probably damaging 1.00
R3862:Nsmaf UTSW 4 6435064 missense probably benign 0.00
R4112:Nsmaf UTSW 4 6417188 nonsense probably null
R4644:Nsmaf UTSW 4 6419940 splice site probably benign
R4807:Nsmaf UTSW 4 6398542 splice site probably null
R4960:Nsmaf UTSW 4 6423342 missense probably damaging 1.00
R5556:Nsmaf UTSW 4 6398621 missense probably benign 0.00
R5936:Nsmaf UTSW 4 6421017 intron probably benign
R7288:Nsmaf UTSW 4 6416641 missense probably benign
R7295:Nsmaf UTSW 4 6438083 missense probably benign 0.00
R7378:Nsmaf UTSW 4 6416586 missense probably benign
R7615:Nsmaf UTSW 4 6408563 missense probably damaging 1.00
R7993:Nsmaf UTSW 4 6398647 missense probably benign 0.15
X0021:Nsmaf UTSW 4 6398543 critical splice donor site probably null
X0063:Nsmaf UTSW 4 6414962 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGGGTACTTTTGCAATAAC -3'
(R):5'- AGCCTTATGTGATTGACTACTTGG -3'

Sequencing Primer
(F):5'- GGGTACTTTTGCAATAACTGTTAATG -3'
(R):5'- TTGTATCCACTTATTGGTGATTCAC -3'
Posted On2019-12-20