Incidental Mutation 'R7842:Ccdc180'
ID606363
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7842 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45909428 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 532 (N532I)
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
Predicted Effect
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: N524I

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151024
SMART Domains Protein: ENSMUSP00000122332
Gene: ENSMUSG00000035539

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
coiled coil region 90 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178561
AA Change: N532I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: N532I

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Abca6 A G 11: 110,196,697 L1135P possibly damaging Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Dusp22 T A 13: 30,668,791 probably null Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Gucy2c C T 6: 136,769,816 probably null Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Klhdc7a A G 4: 139,967,238 S133P probably damaging Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map2 T A 1: 66,416,411 D1421E probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Mxra8 A G 4: 155,842,910 D384G probably damaging Het
Myo15b A G 11: 115,871,495 T1214A Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nsmaf T A 4: 6,435,109 probably null Het
Nynrin A G 14: 55,865,096 R741G probably damaging Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Qrich1 T A 9: 108,556,368 probably null Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Ube4a A G 9: 44,949,727 probably null Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45914803 missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0362:Ccdc180 UTSW 4 45923551 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0546:Ccdc180 UTSW 4 45904597 missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4811:Ccdc180 UTSW 4 45928020 missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45914588 missense probably benign
R7341:Ccdc180 UTSW 4 45898644 missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R7418:Ccdc180 UTSW 4 45904616 missense probably damaging 0.98
R7492:Ccdc180 UTSW 4 45930009 splice site probably null
R7573:Ccdc180 UTSW 4 45922015 missense probably benign 0.33
R7639:Ccdc180 UTSW 4 45928043 missense possibly damaging 0.93
R7792:Ccdc180 UTSW 4 45890389 critical splice donor site probably null
R7806:Ccdc180 UTSW 4 45912801 missense possibly damaging 0.85
R7812:Ccdc180 UTSW 4 45906952 critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Z1176:Ccdc180 UTSW 4 45916406 missense probably damaging 1.00
Z1176:Ccdc180 UTSW 4 45920910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCAGAACTCCTTTGAGG -3'
(R):5'- TACTTCCATCCCCAGGATCCAG -3'

Sequencing Primer
(F):5'- TTGAGGATTTGGCCAGGGAGAC -3'
(R):5'- GGGGTCTCTACCTACACGTATATTG -3'
Posted On2019-12-20