Incidental Mutation 'R7842:Klhdc7a'
ID606369
Institutional Source Beutler Lab
Gene Symbol Klhdc7a
Ensembl Gene ENSMUSG00000078234
Gene Namekelch domain containing 7A
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7842 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location139960220-139968026 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 139967238 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 133 (S133P)
Ref Sequence ENSEMBL: ENSMUSP00000100648 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105031]
Predicted Effect probably damaging
Transcript: ENSMUST00000105031
AA Change: S133P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100648
Gene: ENSMUSG00000078234
AA Change: S133P

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 81 93 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
Kelch 537 585 4.83e-2 SMART
Kelch 586 631 4.98e-4 SMART
low complexity region 756 769 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Abca6 A G 11: 110,196,697 L1135P possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 N532I probably benign Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map2 T A 1: 66,416,411 D1421E probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Mxra8 A G 4: 155,842,910 D384G probably damaging Het
Myo15b A G 11: 115,871,495 T1214A Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nsmaf T A 4: 6,435,109 probably null Het
Nynrin A G 14: 55,865,096 R741G probably damaging Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Other mutations in Klhdc7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Klhdc7a APN 4 139966925 missense probably benign 0.00
IGL01588:Klhdc7a APN 4 139966946 missense probably damaging 0.98
IGL01593:Klhdc7a APN 4 139966814 missense probably damaging 1.00
IGL01719:Klhdc7a APN 4 139966550 missense probably damaging 1.00
IGL02333:Klhdc7a APN 4 139967156 missense probably benign 0.07
IGL02481:Klhdc7a APN 4 139965810 missense probably benign 0.25
R0153:Klhdc7a UTSW 4 139967271 missense possibly damaging 0.83
R0385:Klhdc7a UTSW 4 139966705 missense probably benign
R1280:Klhdc7a UTSW 4 139965453 missense probably benign 0.01
R1456:Klhdc7a UTSW 4 139965524 missense possibly damaging 0.46
R1837:Klhdc7a UTSW 4 139967070 missense probably benign 0.31
R1838:Klhdc7a UTSW 4 139967070 missense probably benign 0.31
R1987:Klhdc7a UTSW 4 139966024 nonsense probably null
R2172:Klhdc7a UTSW 4 139965810 missense probably benign 0.25
R2220:Klhdc7a UTSW 4 139965453 missense probably benign 0.01
R3154:Klhdc7a UTSW 4 139965713 missense probably benign 0.20
R3155:Klhdc7a UTSW 4 139967189 missense probably benign 0.01
R4242:Klhdc7a UTSW 4 139966721 missense probably benign 0.01
R4349:Klhdc7a UTSW 4 139966277 missense possibly damaging 0.67
R5859:Klhdc7a UTSW 4 139967574 missense probably damaging 0.96
R6316:Klhdc7a UTSW 4 139966802 missense probably benign 0.00
R6342:Klhdc7a UTSW 4 139967059 missense probably benign 0.09
R6755:Klhdc7a UTSW 4 139966475 missense possibly damaging 0.80
R7528:Klhdc7a UTSW 4 139967517 missense probably damaging 1.00
R7648:Klhdc7a UTSW 4 139965939 missense possibly damaging 0.66
R7843:Klhdc7a UTSW 4 139966844 missense possibly damaging 0.87
R7925:Klhdc7a UTSW 4 139967238 missense probably damaging 0.97
R7926:Klhdc7a UTSW 4 139966844 missense possibly damaging 0.87
X0002:Klhdc7a UTSW 4 139966364 small deletion probably benign
Z1176:Klhdc7a UTSW 4 139967797 start gained probably benign
Z1177:Klhdc7a UTSW 4 139965662 missense probably benign 0.14
Z1177:Klhdc7a UTSW 4 139967000 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCAGTGTAAGATCAGTCCAACCG -3'
(R):5'- GACAACTTGCCTTCCAGGAG -3'

Sequencing Primer
(F):5'- CAGATCCTGTTTCCTCTGGGG -3'
(R):5'- TTGCCTTCCAGGAGGCTCC -3'
Posted On2019-12-20