Incidental Mutation 'R7842:Mxra8'
ID606370
Institutional Source Beutler Lab
Gene Symbol Mxra8
Ensembl Gene ENSMUSG00000029070
Gene Namematrix-remodelling associated 8
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7842 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155839680-155844088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155842910 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 384 (D384G)
Ref Sequence ENSEMBL: ENSMUSP00000030947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030947] [ENSMUST00000030948] [ENSMUST00000141883] [ENSMUST00000168552]
Predicted Effect probably damaging
Transcript: ENSMUST00000030947
AA Change: D384G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030947
Gene: ENSMUSG00000029070
AA Change: D384G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 38 156 6.16e-4 SMART
IG 170 291 9.71e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
low complexity region 371 384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000030948
SMART Domains Protein: ENSMUSP00000030948
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 144 215 1.1e-31 PFAM
low complexity region 217 233 N/A INTRINSIC
low complexity region 235 246 N/A INTRINSIC
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 4.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141883
SMART Domains Protein: ENSMUSP00000114929
Gene: ENSMUSG00000029070

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 35 153 6.16e-4 SMART
IG 167 288 9.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168552
SMART Domains Protein: ENSMUSP00000133137
Gene: ENSMUSG00000029071

DomainStartEndE-ValueType
DAX 1 85 2.17e-52 SMART
Pfam:Dishevelled 90 247 1.7e-60 PFAM
PDZ 260 339 3.13e-16 SMART
low complexity region 380 397 N/A INTRINSIC
DEP 425 499 1.47e-26 SMART
Pfam:Dsh_C 503 685 7.6e-59 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Phenotypic analysis of mice homozygous for a gene trap allele indicates this mutation has no notable phenotype in any parameter tested in a high-throughput screen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Abca6 A G 11: 110,196,697 L1135P possibly damaging Het
Abcb11 GTTGATCCATACA G 2: 69,323,873 probably benign Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 N532I probably benign Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Klhdc7a A G 4: 139,967,238 S133P probably damaging Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map2 T A 1: 66,416,411 D1421E probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Myo15b A G 11: 115,871,495 T1214A Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nsmaf T A 4: 6,435,109 probably null Het
Nynrin A G 14: 55,865,096 R741G probably damaging Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Other mutations in Mxra8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Mxra8 APN 4 155842563 missense probably benign 0.06
IGL01871:Mxra8 APN 4 155842801 missense probably benign
IGL02900:Mxra8 APN 4 155841119 missense possibly damaging 0.52
IGL02900:Mxra8 APN 4 155841211 splice site probably null
Buffet UTSW 4 155843136 missense possibly damaging 0.89
R0206:Mxra8 UTSW 4 155842596 missense probably damaging 0.97
R0206:Mxra8 UTSW 4 155842596 missense probably damaging 0.97
R0513:Mxra8 UTSW 4 155841733 missense probably benign 0.00
R1318:Mxra8 UTSW 4 155841499 missense probably damaging 1.00
R1414:Mxra8 UTSW 4 155841007 missense probably damaging 0.99
R1775:Mxra8 UTSW 4 155843074 missense probably damaging 1.00
R2473:Mxra8 UTSW 4 155842043 missense probably damaging 0.99
R4270:Mxra8 UTSW 4 155841137 missense probably damaging 0.96
R4519:Mxra8 UTSW 4 155842983 critical splice donor site probably null
R4844:Mxra8 UTSW 4 155842694 missense probably benign 0.19
R4849:Mxra8 UTSW 4 155840874 intron probably benign
R4912:Mxra8 UTSW 4 155840904 splice site probably null
R4929:Mxra8 UTSW 4 155842661 missense probably damaging 1.00
R5567:Mxra8 UTSW 4 155841008 missense probably damaging 1.00
R5665:Mxra8 UTSW 4 155842921 missense probably benign 0.01
R5913:Mxra8 UTSW 4 155843303 critical splice acceptor site probably null
R6250:Mxra8 UTSW 4 155841089 missense possibly damaging 0.95
R6857:Mxra8 UTSW 4 155843136 missense possibly damaging 0.89
R7142:Mxra8 UTSW 4 155843062 missense probably benign 0.23
R7658:Mxra8 UTSW 4 155842963 missense probably benign 0.04
R7925:Mxra8 UTSW 4 155842910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCCAGATTAACCGAGAAC -3'
(R):5'- AAAGTGCTCACCTTTATCCAGATC -3'

Sequencing Primer
(F):5'- CCCAGATTAACCGAGAACAGTGAG -3'
(R):5'- AGATCCACATCCTTGGCAGG -3'
Posted On2019-12-20