Mutagenetix > Incidental Mutations

Incidental Mutation 'R7842:Brdt'

606373

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7842 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107348588 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 189 (N189D)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215] [ENSMUST00000112677]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031215
AA Change: N189D

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: N189D

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112677
AA Change: N189D

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000108297
Gene: ENSMUSG00000029279
AA Change: N189D

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
Pfam:Bromodomain	275	326	2.7e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J05Rik	T	C	6: 146,953,536	T3A	unknown	Het
4933412E24Rik	T	C	15: 60,016,573	E6G	probably damaging	Het
Abca6	A	G	11: 110,196,697	L1135P	possibly damaging	Het
Agps	A	G	2: 75,851,532	D113G	probably damaging	Het
Ankhd1	G	T	18: 36,647,828	V1978L	probably benign	Het
Ankrd31	T	A	13: 96,821,458		probably null	Het
Arhgap5	T	A	12: 52,518,697	M817K	possibly damaging	Het
Bdp1	C	A	13: 100,099,129	V105F	probably damaging	Het
Ccdc180	A	T	4: 45,909,428	N532I	probably benign	Het
Ccnc	A	C	4: 21,730,480	K39T	probably damaging	Het
Cfap57	C	A	4: 118,554,755	G1231*	probably null	Het
Chd7	A	T	4: 8,854,115	T1896S	probably benign	Het
Clk4	A	T	11: 51,281,129	H412L	probably benign	Het
Creld1	T	C	6: 113,488,139	L109P	probably damaging	Het
Cxxc4	A	T	3: 134,240,332	I225L	possibly damaging	Het
Cyp4f39	A	T	17: 32,483,317	R263W	probably benign	Het
Dip2c	T	C	13: 9,606,533		probably null	Het
Dnah14	A	G	1: 181,627,898	T863A	probably damaging	Het
Dnah17	C	A	11: 118,079,682		probably null	Het
Dnajc10	A	G	2: 80,345,065	K599E	probably benign	Het
Dnajc7	C	A	11: 100,598,718	R101L	probably benign	Het
Dnttip2	G	A	3: 122,276,341	E402K	probably benign	Het
Dusp22	T	A	13: 30,668,791		probably null	Het
Egflam	C	A	15: 7,251,194	R450M	probably null	Het
Eml5	C	T	12: 98,794,135	R1785Q	probably damaging	Het
Fam205c	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG	4: 42,871,823		probably benign	Het
Fam45a	G	A	19: 60,830,879	A263T	not run	Het
Fam78b	G	T	1: 167,001,609	R15L	probably damaging	Het
Fbxl5	A	T	5: 43,758,603	I489N	probably damaging	Het
Flt3	G	A	5: 147,334,453	P893S	probably damaging	Het
Gm17019	T	C	5: 15,031,035	M131V	possibly damaging	Het
Gm21560	T	A	14: 6,216,262	I194F	probably benign	Het
Gm28729	T	C	9: 96,517,652	D158G	probably damaging	Het
Gucy2c	C	T	6: 136,769,816		probably null	Het
Hectd1	C	T	12: 51,772,560	G1247S	probably damaging	Het
Ireb2	T	A	9: 54,909,686	I946K	probably benign	Het
Itgb4	A	T	11: 115,982,705	D249V	probably benign	Het
Klhdc7a	A	G	4: 139,967,238	S133P	probably damaging	Het
Lsr	A	T	7: 30,966,012	D172E	possibly damaging	Het
Macf1	T	C	4: 123,526,909	E184G	probably benign	Het
Map2	T	A	1: 66,416,411	D1421E	probably benign	Het
Map3k4	A	T	17: 12,271,143	L467H	possibly damaging	Het
Mogat1	T	C	1: 78,522,865		probably null	Het
Mxra8	A	G	4: 155,842,910	D384G	probably damaging	Het
Myo15b	A	G	11: 115,871,495	T1214A		Het
Naip1	T	C	13: 100,426,998	Y553C	probably damaging	Het
Nln	A	T	13: 104,052,629	I278K	probably benign	Het
Nsmaf	T	A	4: 6,435,109		probably null	Het
Nynrin	A	G	14: 55,865,096	R741G	probably damaging	Het
Olfr1045	G	T	2: 86,198,172	Y193*	probably null	Het
Olfr1166	C	T	2: 88,124,986		probably benign	Het
Olfr1208	A	G	2: 88,896,961	V212A	possibly damaging	Het
Olfr603	A	G	7: 103,383,576	V142A	probably benign	Het
Orc1	A	G	4: 108,605,547	H607R	probably benign	Het
Pate2	A	T	9: 35,670,533	Y41F	probably damaging	Het
Pcdhb20	A	T	18: 37,505,059	T213S	possibly damaging	Het
Pcm1	G	A	8: 41,327,584	E1858K	possibly damaging	Het
Pla2g2d	A	G	4: 138,778,778	T59A	probably damaging	Het
Ppl	C	T	16: 5,088,861	R1190H	probably damaging	Het
Prl2c2	A	G	13: 13,005,322	L2P	probably benign	Het
Proz	G	A	8: 13,063,406	V76I	probably benign	Het
Prr36	A	G	8: 4,210,953	S955P	probably benign	Het
Pter	T	C	2: 12,978,541	V119A	probably damaging	Het
Qrich1	T	A	9: 108,556,368		probably null	Het
Rbm15b	T	C	9: 106,885,889	E360G	probably damaging	Het
Skint11	G	A	4: 114,244,771	C327Y	possibly damaging	Het
Spag17	T	A	3: 100,053,858	S987T	probably benign	Het
Tbx1	T	C	16: 18,586,615	S100G	unknown	Het
Tiam2	C	T	17: 3,518,124	S1515L	possibly damaging	Het
Togaram1	C	A	12: 64,966,459	D161E	probably damaging	Het
Trhde	A	T	10: 114,696,098	S366T	possibly damaging	Het
Ttc12	A	G	9: 49,438,424	I691T	possibly damaging	Het
Ube4a	A	G	9: 44,949,727		probably null	Het
Uggt2	A	T	14: 118,998,104	I1453N	probably damaging	Het
Unc79	T	C	12: 103,092,054	S972P	probably damaging	Het
Wdr20	G	A	12: 110,738,215	D63N	probably benign	Het
Wdr66	T	C	5: 123,254,424	V207A	unknown	Het
Wls	T	A	3: 159,873,179	I126N	probably benign	Het
Xirp2	A	G	2: 67,524,945	D3350G	probably benign	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TATGACTAAGTCGTCAGCAACAG -3'
(R):5'- ACAAGTTTAAAGGCACAGCG -3'

Sequencing Primer
(F):5'- ACTGGGGCTTATTTTTCCAACTG -3'
(R):5'- ACACCTGTAGTTCCAGTACTGTGAG -3'

Posted On

2019-12-20