Mutagenetix > Incidental Mutations

Incidental Mutation 'R0083:Ass1'

60638

Institutional Source

Beutler Lab

Gene Symbol

Ass1

Ensembl Gene

ENSMUSG00000076441

Gene Name

argininosuccinate synthetase 1

Synonyms

Ass-1, ASS, fold

MMRRC Submission

038370-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0083 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31470207-31520672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31514819 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 371 (N371Y)

Ref Sequence

ENSEMBL: ENSMUSP00000099904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102840]

Predicted Effect

probably damaging
Transcript: ENSMUST00000102840
AA Change: N371Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: N371Y

Domain	Start	End	E-Value	Type
Pfam:QueC	6	93	2.8e-7	PFAM
Pfam:Arginosuc_synth	8	403	1.9e-177	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126474

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192802

Meta Mutation Damage Score

0.9349

Coding Region Coverage

1x: 99.1%
3x: 97.8%
10x: 94.0%
20x: 83.1%

Validation Efficiency

88% (117/133)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	A	T	2: 85,494,132	F283L	possibly damaging	Het
4930562C15Rik	A	T	16: 4,849,542	I266F	unknown	Het
Adam39	T	G	8: 40,825,078	F169V	probably damaging	Het
Adcy2	A	T	13: 68,651,935	V858E	probably damaging	Het
Adgrv1	A	G	13: 81,578,404		probably benign	Het
Ankrd26	G	T	6: 118,523,254	H1085Q	probably benign	Het
Atg4c	C	T	4: 99,221,440	H215Y	possibly damaging	Het
Atp6v0d2	G	A	4: 19,880,001		probably benign	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
C1qtnf3	G	A	15: 10,975,632	V175I	possibly damaging	Het
Cacna1c	A	G	6: 118,625,523	M1293T	probably damaging	Het
Ccdc88a	T	A	11: 29,503,463	S337T	probably damaging	Het
Cntn4	A	G	6: 106,525,369	I362M	possibly damaging	Het
Col22a1	A	T	15: 71,890,497	D104E	possibly damaging	Het
Col4a4	T	C	1: 82,507,111		probably null	Het
Cul7	C	A	17: 46,655,556	R304S	probably benign	Het
Elfn2	A	T	15: 78,673,414	L311Q	probably damaging	Het
Esrrb	T	C	12: 86,514,452	L320P	probably damaging	Het
Fbxw10	A	G	11: 62,877,061	T903A	probably benign	Het
Fkbp4	G	A	6: 128,432,407		probably benign	Het
Gatad2b	T	A	3: 90,357,943	Y576N	probably damaging	Het
Greb1	T	C	12: 16,696,451	M1273V	probably benign	Het
Helq	C	A	5: 100,768,368	E913*	probably null	Het
Inpp4b	C	A	8: 81,741,462	A18E	possibly damaging	Het
Ints13	A	G	6: 146,550,664	Y686H	probably benign	Het
Itgb7	C	T	15: 102,223,482	R222H	probably damaging	Het
Krt81	A	G	15: 101,463,465	I78T	probably damaging	Het
Lonp2	G	A	8: 86,716,355	V815I	probably benign	Het
Mctp2	G	T	7: 72,228,516	F271L	possibly damaging	Het
Mrto4	C	T	4: 139,347,968	V175I	possibly damaging	Het
Myh14	A	G	7: 44,634,519	V654A	probably damaging	Het
Neu2	A	G	1: 87,597,262	Y323C	probably damaging	Het
Nt5dc1	A	C	10: 34,403,764	M94R	probably damaging	Het
Nup210l	A	G	3: 90,189,575	T1364A	probably damaging	Het
Obscn	T	C	11: 59,022,374	D6939G	probably damaging	Het
Olfr1491	A	T	19: 13,705,678	T284S	probably damaging	Het
Pias4	A	G	10: 81,164,166	S18P	probably damaging	Het
Plcl1	A	G	1: 55,697,939	Y813C	possibly damaging	Het
Plk5	G	A	10: 80,356,662	G34S	possibly damaging	Het
Ptprj	A	T	2: 90,469,777		probably null	Het
Rps6ka2	G	A	17: 7,296,043	D617N	probably benign	Het
Sap130	C	A	18: 31,666,329		probably benign	Het
Sap130	C	T	18: 31,711,641	P902S	probably damaging	Het
Sec11a	A	G	7: 80,935,039	V50A	probably damaging	Het
Sel1l3	C	T	5: 53,137,902	A786T	possibly damaging	Het
Shroom1	T	C	11: 53,466,937	S772P	possibly damaging	Het
Slc15a2	T	C	16: 36,782,283	Y72C	probably damaging	Het
Slc26a6	T	C	9: 108,859,113		probably null	Het
Slc30a5	G	T	13: 100,803,400	A669E	probably damaging	Het
Sppl2c	G	A	11: 104,186,532	V53I	probably benign	Het
Sstr1	T	A	12: 58,213,742	C384S	possibly damaging	Het
Sulf1	A	G	1: 12,817,417	M272V	probably damaging	Het
Tm6sf1	G	A	7: 81,865,345		probably null	Het
Tmem94	A	G	11: 115,796,724		probably benign	Het
Topaz1	A	T	9: 122,775,609	I1093L	probably benign	Het
Ttll4	G	T	1: 74,679,769	V260L	probably benign	Het
Vmn2r26	A	T	6: 124,053,981		probably null	Het
Vmn2r75	G	A	7: 86,165,658	A209V	probably benign	Het
Zfand3	A	G	17: 30,135,398	E63G	probably damaging	Het
Zfp939	A	T	7: 39,474,110		noncoding transcript	Het

Other mutations in Ass1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Ass1	APN	2	31476922	missense	probably damaging	1.00
IGL02152:Ass1	APN	2	31492324	missense	probably damaging	1.00
R0008:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0084:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0085:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0087:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0183:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0220:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0254:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0302:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0346:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0440:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0472:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0605:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0644:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R1460:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1770:Ass1	UTSW	2	31486516	missense	probably benign	0.29
R1908:Ass1	UTSW	2	31493148	nonsense	probably null
R2361:Ass1	UTSW	2	31520382	missense	probably benign	0.02
R2430:Ass1	UTSW	2	31501496	missense	probably damaging	1.00
R3816:Ass1	UTSW	2	31510105	splice site	probably benign
R4614:Ass1	UTSW	2	31514783	missense	probably damaging	1.00
R4628:Ass1	UTSW	2	31480988	missense	probably damaging	1.00
R5007:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90
R5069:Ass1	UTSW	2	31510173	missense	probably damaging	1.00
R5081:Ass1	UTSW	2	31488653	critical splice donor site	probably null
R5315:Ass1	UTSW	2	31492329	missense	probably benign	0.21
R5370:Ass1	UTSW	2	31518733	missense	possibly damaging	0.56
R6259:Ass1	UTSW	2	31488642	missense	possibly damaging	0.80
R6541:Ass1	UTSW	2	31510233	missense	probably damaging	0.99
R6731:Ass1	UTSW	2	31514784	missense	probably damaging	1.00
R6927:Ass1	UTSW	2	31514801	missense	probably damaging	1.00
R7811:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R7995:Ass1	UTSW	2	31486540	missense	probably benign	0.00
R8504:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AGTAAGGCAGAACCGAGCCTATCAG -3'
(R):5'- TGCGCCACAGCCTAACTTTTATACC -3'

Sequencing Primer
(F):5'- CCGAGCCTATCAGAAGGTAAG -3'
(R):5'- attactttgcatcagaaaatgacac -3'

Posted On

2013-07-24