Incidental Mutation 'R7842:Myo15b'
ID606392
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7842 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115871495 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1214 (T1214A)
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911]
Predicted Effect
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: T1214A

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Abca6 A G 11: 110,196,697 L1135P possibly damaging Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 N532I probably benign Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Dusp22 T A 13: 30,668,791 probably null Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Gucy2c C T 6: 136,769,816 probably null Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Klhdc7a A G 4: 139,967,238 S133P probably damaging Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map2 T A 1: 66,416,411 D1421E probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Mxra8 A G 4: 155,842,910 D384G probably damaging Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nsmaf T A 4: 6,435,109 probably null Het
Nynrin A G 14: 55,865,096 R741G probably damaging Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Qrich1 T A 9: 108,556,368 probably null Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Ube4a A G 9: 44,949,727 probably null Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
R6963:Myo15b UTSW 11 115890714 splice site probably null
R7015:Myo15b UTSW 11 115871844 missense
R7020:Myo15b UTSW 11 115866667 nonsense probably null
R7096:Myo15b UTSW 11 115891498 splice site probably null
R7219:Myo15b UTSW 11 115877095 critical splice donor site probably null
R7400:Myo15b UTSW 11 115860113 missense
R7413:Myo15b UTSW 11 115878144 missense
R7483:Myo15b UTSW 11 115858744 missense
R7523:Myo15b UTSW 11 115890858 missense unknown
R7737:Myo15b UTSW 11 115887923 missense unknown
R7784:Myo15b UTSW 11 115861340 missense
R7921:Myo15b UTSW 11 115887178 nonsense probably null
R8065:Myo15b UTSW 11 115887943 critical splice donor site probably null
R8193:Myo15b UTSW 11 115885147 missense probably damaging 1.00
R8237:Myo15b UTSW 11 115877001 missense
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Z1176:Myo15b UTSW 11 115883452 missense possibly damaging 0.81
Z1176:Myo15b UTSW 11 115887925 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTTCAGGTGCACAGAGAGC -3'
(R):5'- TTGGAGAAAGAGGGCTCACC -3'

Sequencing Primer
(F):5'- TGCACAGAGAGCTTTGCG -3'
(R):5'- ACCTTTCCAGGGGTGGG -3'
Posted On2019-12-20