Incidental Mutation 'R7842:4933412E24Rik'
ID 606411
Institutional Source Beutler Lab
Gene Symbol 4933412E24Rik
Ensembl Gene ENSMUSG00000071749
Gene Name RIKEN cDNA 4933412E24 gene
Synonyms
MMRRC Submission 045896-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7842 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 59886715-59888462 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59888422 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 6 (E6G)
Ref Sequence ENSEMBL: ENSMUSP00000094154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096421]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000096421
AA Change: E6G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000094154
Gene: ENSMUSG00000071749
AA Change: E6G

DomainStartEndE-ValueType
Pfam:DUF4641 79 509 5.4e-189 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,855,034 (GRCm39) T3A unknown Het
Abca6 A G 11: 110,087,523 (GRCm39) L1135P possibly damaging Het
Agps A G 2: 75,681,876 (GRCm39) D113G probably damaging Het
Ankhd1 G T 18: 36,780,881 (GRCm39) V1978L probably benign Het
Ankrd31 T A 13: 96,957,966 (GRCm39) probably null Het
Arhgap5 T A 12: 52,565,480 (GRCm39) M817K possibly damaging Het
Bdp1 C A 13: 100,235,637 (GRCm39) V105F probably damaging Het
Brdt A G 5: 107,496,454 (GRCm39) N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 (GRCm39) N532I probably benign Het
Ccnc A C 4: 21,730,480 (GRCm39) K39T probably damaging Het
Cfap251 T C 5: 123,392,487 (GRCm39) V207A unknown Het
Cfap57 C A 4: 118,411,952 (GRCm39) G1231* probably null Het
Chd7 A T 4: 8,854,115 (GRCm39) T1896S probably benign Het
Clk4 A T 11: 51,171,956 (GRCm39) H412L probably benign Het
Creld1 T C 6: 113,465,100 (GRCm39) L109P probably damaging Het
Cxxc4 A T 3: 133,946,093 (GRCm39) I225L possibly damaging Het
Cyp4f39 A T 17: 32,702,291 (GRCm39) R263W probably benign Het
Dennd10 G A 19: 60,819,317 (GRCm39) A263T not run Het
Dip2c T C 13: 9,656,569 (GRCm39) probably null Het
Dnah14 A G 1: 181,455,463 (GRCm39) T863A probably damaging Het
Dnah17 C A 11: 117,970,508 (GRCm39) probably null Het
Dnajc10 A G 2: 80,175,409 (GRCm39) K599E probably benign Het
Dnajc7 C A 11: 100,489,544 (GRCm39) R101L probably benign Het
Dnttip2 G A 3: 122,069,990 (GRCm39) E402K probably benign Het
Dusp22 T A 13: 30,852,774 (GRCm39) probably null Het
Egflam C A 15: 7,280,675 (GRCm39) R450M probably null Het
Eml5 C T 12: 98,760,394 (GRCm39) R1785Q probably damaging Het
Fam78b G T 1: 166,829,178 (GRCm39) R15L probably damaging Het
Fbxl5 A T 5: 43,915,945 (GRCm39) I489N probably damaging Het
Flt3 G A 5: 147,271,263 (GRCm39) P893S probably damaging Het
Gm17019 T C 5: 15,081,049 (GRCm39) M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 (GRCm38) I194F probably benign Het
Gm28729 T C 9: 96,399,705 (GRCm39) D158G probably damaging Het
Gucy2c C T 6: 136,746,814 (GRCm39) probably null Het
Hectd1 C T 12: 51,819,343 (GRCm39) G1247S probably damaging Het
Ireb2 T A 9: 54,816,970 (GRCm39) I946K probably benign Het
Itgb4 A T 11: 115,873,531 (GRCm39) D249V probably benign Het
Klhdc7a A G 4: 139,694,549 (GRCm39) S133P probably damaging Het
Lsr A T 7: 30,665,437 (GRCm39) D172E possibly damaging Het
Macf1 T C 4: 123,420,702 (GRCm39) E184G probably benign Het
Map2 T A 1: 66,455,570 (GRCm39) D1421E probably benign Het
Map3k4 A T 17: 12,490,030 (GRCm39) L467H possibly damaging Het
Mogat1 T C 1: 78,499,502 (GRCm39) probably null Het
Mxra8 A G 4: 155,927,367 (GRCm39) D384G probably damaging Het
Myo15b A G 11: 115,762,321 (GRCm39) T1214A Het
Naip1 T C 13: 100,563,506 (GRCm39) Y553C probably damaging Het
Nln A T 13: 104,189,137 (GRCm39) I278K probably benign Het
Nsmaf T A 4: 6,435,109 (GRCm39) probably null Het
Nynrin A G 14: 56,102,553 (GRCm39) R741G probably damaging Het
Or4p8 A G 2: 88,727,305 (GRCm39) V212A possibly damaging Het
Or52e19b A G 7: 103,032,783 (GRCm39) V142A probably benign Het
Or5d38 C T 2: 87,955,330 (GRCm39) probably benign Het
Or8j3 G T 2: 86,028,516 (GRCm39) Y193* probably null Het
Orc1 A G 4: 108,462,744 (GRCm39) H607R probably benign Het
Pate2 A T 9: 35,581,829 (GRCm39) Y41F probably damaging Het
Pcdhb20 A T 18: 37,638,112 (GRCm39) T213S possibly damaging Het
Pcm1 G A 8: 41,780,621 (GRCm39) E1858K possibly damaging Het
Pla2g2d A G 4: 138,506,089 (GRCm39) T59A probably damaging Het
Ppl C T 16: 4,906,725 (GRCm39) R1190H probably damaging Het
Prl2c2 A G 13: 13,179,907 (GRCm39) L2P probably benign Het
Proz G A 8: 13,113,406 (GRCm39) V76I probably benign Het
Prr36 A G 8: 4,260,953 (GRCm39) S955P probably benign Het
Pter T C 2: 12,983,352 (GRCm39) V119A probably damaging Het
Qrich1 T A 9: 108,433,567 (GRCm39) probably null Het
Rbm15b T C 9: 106,763,088 (GRCm39) E360G probably damaging Het
Skint11 G A 4: 114,101,968 (GRCm39) C327Y possibly damaging Het
Spag17 T A 3: 99,961,174 (GRCm39) S987T probably benign Het
Spata31f3 TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 (GRCm39) probably benign Het
Tbx1 T C 16: 18,405,365 (GRCm39) S100G unknown Het
Tiam2 C T 17: 3,568,399 (GRCm39) S1515L possibly damaging Het
Togaram1 C A 12: 65,013,233 (GRCm39) D161E probably damaging Het
Trhde A T 10: 114,532,003 (GRCm39) S366T possibly damaging Het
Ttc12 A G 9: 49,349,724 (GRCm39) I691T possibly damaging Het
Ube4a A G 9: 44,861,025 (GRCm39) probably null Het
Uggt2 A T 14: 119,235,516 (GRCm39) I1453N probably damaging Het
Unc79 T C 12: 103,058,313 (GRCm39) S972P probably damaging Het
Wdr20 G A 12: 110,704,649 (GRCm39) D63N probably benign Het
Wls T A 3: 159,578,816 (GRCm39) I126N probably benign Het
Xirp2 A G 2: 67,355,289 (GRCm39) D3350G probably benign Het
Other mutations in 4933412E24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:4933412E24Rik APN 15 59,887,424 (GRCm39) missense possibly damaging 0.82
IGL02078:4933412E24Rik APN 15 59,888,179 (GRCm39) missense probably benign 0.02
IGL02493:4933412E24Rik APN 15 59,888,312 (GRCm39) missense probably benign 0.00
IGL03336:4933412E24Rik APN 15 59,888,251 (GRCm39) missense probably benign 0.00
R0466:4933412E24Rik UTSW 15 59,887,321 (GRCm39) missense probably benign 0.00
R0961:4933412E24Rik UTSW 15 59,887,160 (GRCm39) missense probably benign 0.36
R1765:4933412E24Rik UTSW 15 59,887,194 (GRCm39) nonsense probably null
R2341:4933412E24Rik UTSW 15 59,888,212 (GRCm39) missense possibly damaging 0.85
R2440:4933412E24Rik UTSW 15 59,888,129 (GRCm39) missense probably benign
R3162:4933412E24Rik UTSW 15 59,888,134 (GRCm39) missense probably damaging 1.00
R3162:4933412E24Rik UTSW 15 59,888,134 (GRCm39) missense probably damaging 1.00
R4039:4933412E24Rik UTSW 15 59,888,215 (GRCm39) missense possibly damaging 0.95
R4416:4933412E24Rik UTSW 15 59,888,272 (GRCm39) missense possibly damaging 0.88
R4868:4933412E24Rik UTSW 15 59,887,817 (GRCm39) missense possibly damaging 0.50
R4907:4933412E24Rik UTSW 15 59,887,957 (GRCm39) missense probably benign 0.00
R5462:4933412E24Rik UTSW 15 59,886,917 (GRCm39) missense probably benign 0.09
R7275:4933412E24Rik UTSW 15 59,887,738 (GRCm39) missense probably benign 0.32
R8261:4933412E24Rik UTSW 15 59,888,425 (GRCm39) missense probably benign 0.44
R8297:4933412E24Rik UTSW 15 59,887,524 (GRCm39) missense probably damaging 1.00
R8378:4933412E24Rik UTSW 15 59,886,967 (GRCm39) missense probably damaging 0.99
R8808:4933412E24Rik UTSW 15 59,887,919 (GRCm39) missense probably benign 0.00
X0052:4933412E24Rik UTSW 15 59,888,375 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACTACCTTTTCATCCATTGGGG -3'
(R):5'- CTTTAGGAGAAAACCAGAGTCGTAG -3'

Sequencing Primer
(F):5'- CAGGGAATCTGGACAGTATTCTCC -3'
(R):5'- TCGTAGTAGAAACCCCTGGTG -3'
Posted On 2019-12-20