Incidental Mutation 'R0083:Fkbp4'
ID60642
Institutional Source Beutler Lab
Gene Symbol Fkbp4
Ensembl Gene ENSMUSG00000030357
Gene NameFK506 binding protein 4
SynonymsFKBP52, FKBP-52
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.849) question?
Stock #R0083 (G1)
Quality Score114
Status Validated
Chromosome6
Chromosomal Location128429735-128438677 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 128432407 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032508] [ENSMUST00000150387] [ENSMUST00000151796]
Predicted Effect probably benign
Transcript: ENSMUST00000032508
SMART Domains Protein: ENSMUSP00000032508
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 2.6e-33 PFAM
Pfam:FKBP_C 160 250 1.3e-14 PFAM
TPR 270 303 4.44e1 SMART
TPR 319 352 1.76e-5 SMART
TPR 353 386 2e-4 SMART
low complexity region 419 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139448
SMART Domains Protein: ENSMUSP00000114939
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 3.8e-33 PFAM
Pfam:FKBP_C 160 250 2.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150387
SMART Domains Protein: ENSMUSP00000119930
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 7.8e-31 PFAM
Pfam:FKBP_C 113 203 4.7e-13 PFAM
Blast:TPR 223 256 3e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151796
SMART Domains Protein: ENSMUSP00000122087
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 3.7e-31 PFAM
Pfam:FKBP_C 113 187 3.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null males show reproductive tissue defects consistent with androgen insensitivity such as ambiguous external genitalia, dysgenic prostate, malformed seminal gland and cryptorchism. Males also exhibit hypospadia and infertility. Females are sterile due to failure of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Myh14 A G 7: 44,634,519 V654A probably damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Fkbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Fkbp4 APN 6 128435791 missense probably benign 0.28
IGL02215:Fkbp4 APN 6 128434470 splice site probably benign
IGL02607:Fkbp4 APN 6 128434470 splice site probably benign
IGL03186:Fkbp4 APN 6 128434800 missense probably benign
IGL03238:Fkbp4 APN 6 128434757 missense probably damaging 1.00
R0491:Fkbp4 UTSW 6 128435742 missense probably damaging 1.00
R1652:Fkbp4 UTSW 6 128436674 missense probably damaging 0.97
R1868:Fkbp4 UTSW 6 128432490 missense probably benign 0.00
R2010:Fkbp4 UTSW 6 128435802 missense probably benign 0.01
R2292:Fkbp4 UTSW 6 128436662 missense probably damaging 1.00
R5616:Fkbp4 UTSW 6 128433554 missense probably damaging 0.99
R6478:Fkbp4 UTSW 6 128433231 missense probably damaging 1.00
R7156:Fkbp4 UTSW 6 128435824 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGAAAACCCTTCTTCTGTCCACTGC -3'
(R):5'- AGCTGACTTCCAAAAGGTCCTGC -3'

Sequencing Primer
(F):5'- tggttggtggaactctttgg -3'
(R):5'- TGCAGCTCTATCCCAGCAAC -3'
Posted On2013-07-24