Incidental Mutation 'R7843:Setx'
ID606423
Institutional Source Beutler Lab
Gene Symbol Setx
Ensembl Gene ENSMUSG00000043535
Gene Namesenataxin
SynonymsA930037J23Rik, Als4
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7843 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location29124181-29182471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29173569 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2292 (N2292K)
Ref Sequence ENSEMBL: ENSMUSP00000051492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061578]
Predicted Effect probably damaging
Transcript: ENSMUST00000061578
AA Change: N2292K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051492
Gene: ENSMUSG00000043535
AA Change: N2292K

DomainStartEndE-ValueType
low complexity region 864 876 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
low complexity region 1058 1079 N/A INTRINSIC
low complexity region 1575 1594 N/A INTRINSIC
Pfam:AAA_11 1909 2194 1.9e-68 PFAM
Pfam:AAA_19 1924 2015 2.9e-11 PFAM
Pfam:AAA_12 2201 2402 1.1e-54 PFAM
low complexity region 2499 2516 N/A INTRINSIC
low complexity region 2576 2587 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000119176
Gene: ENSMUSG00000043535
AA Change: N165K

DomainStartEndE-ValueType
Pfam:AAA_11 1 68 5.8e-26 PFAM
Pfam:AAA_12 75 331 4.5e-54 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein named for its homology to the Sen1p protein of fungi which has RNA helicase activity encoded by a domain at the C-terminal end of the protein. The protein encoded by this gene contains a DNA/RNA helicase domain at its C-terminal end which suggests that it may be involved in both DNA and RNA processing. Mutations in this gene have been associated with ataxia-ocular apraxia-2 (AOA2) and an autosomal dominant form of juvenile amyotrophic lateral sclerosis (ALS4). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility due to arrested male meiosis and reduced female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 35,959,243 D641G possibly damaging Het
Adam1b A T 5: 121,501,437 I515N probably damaging Het
Adamtsl5 A G 10: 80,342,923 V207A probably damaging Het
Ampd3 A G 7: 110,791,188 I143V probably benign Het
Ank3 A T 10: 69,986,958 T486S probably benign Het
BC051142 C T 17: 34,449,824 T176I possibly damaging Het
Bcl11a A G 11: 24,164,831 I725V probably benign Het
Blmh A G 11: 76,946,313 N29D probably damaging Het
C6 T A 15: 4,808,404 V832D Het
Ccdc191 T A 16: 43,959,336 L777M probably damaging Het
Ccdc74a C G 16: 17,646,749 H45Q Het
Cenpe T A 3: 135,232,959 Y517* probably null Het
Cep290 G T 10: 100,516,188 R752L possibly damaging Het
Cers5 A T 15: 99,772,331 W17R unknown Het
Chpf T C 1: 75,478,287 probably benign Het
Chst5 C A 8: 111,890,572 A139S probably benign Het
Cpn1 T A 19: 43,986,158 D44V probably benign Het
Cstf1 T C 2: 172,378,000 Y344H probably damaging Het
D7Ertd443e A C 7: 134,349,095 M283R possibly damaging Het
Dclk1 T A 3: 55,255,877 V130D probably damaging Het
Dscam C T 16: 96,825,630 V360M probably damaging Het
Dvl2 A G 11: 70,008,786 N518S probably benign Het
Eif2ak2 T A 17: 78,868,774 K231N probably benign Het
Elovl4 T C 9: 83,788,271 R123G probably damaging Het
Ern2 A G 7: 122,173,708 V562A probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Gcc2 C A 10: 58,268,021 Q90K possibly damaging Het
Gnpda1 A T 18: 38,328,899 S282T probably benign Het
Gpatch1 G T 7: 35,281,454 H880Q unknown Het
Haus6 T C 4: 86,586,341 D471G possibly damaging Het
Hcfc1r1 G T 17: 23,674,656 E70* probably null Het
Ighv1-54 A G 12: 115,193,863 W55R probably damaging Het
Jam3 T C 9: 27,106,416 probably null Het
Klhdc7a A T 4: 139,966,844 V264E possibly damaging Het
Lrrc4c A T 2: 97,630,213 T395S probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast2 G T 4: 116,353,011 T186K probably damaging Het
Meig1 T A 2: 3,409,211 K84M probably damaging Het
Mep1b G T 18: 21,095,053 S571I probably damaging Het
Muc2 T G 7: 141,695,419 V507G probably benign Het
Nkx2-3 C A 19: 43,614,882 T309N probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1377 A T 11: 50,985,018 T106S probably benign Het
Olfr1463 A T 19: 13,234,537 N96Y possibly damaging Het
Olfr905 T C 9: 38,472,947 S67P probably damaging Het
Pla2r1 T G 2: 60,447,475 T835P possibly damaging Het
Ppil6 C T 10: 41,501,866 T191I probably benign Het
Rps6ka5 T C 12: 100,553,149 D735G possibly damaging Het
Slc1a6 A T 10: 78,796,260 I307F probably damaging Het
Slc5a3 T A 16: 92,079,019 W655R probably benign Het
Slc9a1 T C 4: 133,370,442 probably benign Het
Sptbn1 A G 11: 30,154,320 V128A probably damaging Het
Tenm3 T A 8: 48,229,111 K2495* probably null Het
Tnni3k T A 3: 155,038,524 T64S probably damaging Het
Top1 T C 2: 160,714,256 V545A possibly damaging Het
Trabd A G 15: 89,081,954 D38G possibly damaging Het
Umad1 G A 6: 8,401,140 D70N unknown Het
Usp36 T C 11: 118,285,965 E9G probably damaging Het
Vmn2r53 A G 7: 12,582,099 S598P probably damaging Het
Vmn2r60 A T 7: 42,195,087 T625S probably benign Het
Vmn2r72 G A 7: 85,749,630 T505I probably benign Het
Vwce T A 19: 10,664,283 I791K probably benign Het
Wdr64 C A 1: 175,812,102 H1046N probably benign Het
Zdhhc4 A T 5: 143,320,276 D232E probably damaging Het
Zfp984 A T 4: 147,757,708 F51I probably damaging Het
Other mutations in Setx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00688:Setx APN 2 29148445 missense possibly damaging 0.50
IGL00806:Setx APN 2 29127026 missense probably damaging 1.00
IGL01346:Setx APN 2 29144809 missense probably damaging 1.00
IGL01623:Setx APN 2 29163009 missense possibly damaging 0.70
IGL02351:Setx APN 2 29146964 missense probably benign 0.45
IGL02358:Setx APN 2 29146964 missense probably benign 0.45
IGL02378:Setx APN 2 29173726 splice site probably benign
IGL02388:Setx APN 2 29173653 missense probably damaging 1.00
IGL02408:Setx APN 2 29133930 missense probably damaging 1.00
IGL02425:Setx APN 2 29148408 missense probably benign 0.00
IGL03023:Setx APN 2 29145902 missense probably benign 0.02
IGL03351:Setx APN 2 29161799 missense probably benign 0.25
Addison UTSW 2 29158905 missense probably damaging 1.00
dallas UTSW 2 29154061 frame shift probably null
Denton UTSW 2 29145060 missense possibly damaging 0.81
doggie UTSW 2 29164550 missense probably damaging 1.00
Irving UTSW 2 29139221 missense probably damaging 0.99
IGL03014:Setx UTSW 2 29139411 missense probably damaging 1.00
PIT4403001:Setx UTSW 2 29133955 missense probably damaging 1.00
R0027:Setx UTSW 2 29139221 missense probably damaging 0.99
R0031:Setx UTSW 2 29176929 missense probably benign 0.02
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0070:Setx UTSW 2 29161525 missense probably benign 0.00
R0092:Setx UTSW 2 29146293 missense probably benign 0.00
R0193:Setx UTSW 2 29179673 missense probably benign 0.21
R0281:Setx UTSW 2 29179643 missense probably benign 0.00
R0401:Setx UTSW 2 29166289 nonsense probably null
R0413:Setx UTSW 2 29139278 missense probably damaging 1.00
R0517:Setx UTSW 2 29157133 missense probably benign 0.00
R0536:Setx UTSW 2 29158248 missense possibly damaging 0.46
R0617:Setx UTSW 2 29146807 missense possibly damaging 0.86
R1183:Setx UTSW 2 29180092 missense probably benign
R1331:Setx UTSW 2 29179686 missense probably benign
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1465:Setx UTSW 2 29140389 critical splice donor site probably null
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1467:Setx UTSW 2 29158905 missense probably damaging 1.00
R1482:Setx UTSW 2 29162992 missense probably damaging 0.99
R1599:Setx UTSW 2 29140373 missense probably benign 0.04
R1663:Setx UTSW 2 29126905 missense probably damaging 1.00
R1909:Setx UTSW 2 29163009 missense possibly damaging 0.70
R2117:Setx UTSW 2 29130301 missense probably benign 0.01
R2207:Setx UTSW 2 29154061 frame shift probably null
R2221:Setx UTSW 2 29154061 frame shift probably null
R2223:Setx UTSW 2 29148537 missense possibly damaging 0.89
R2223:Setx UTSW 2 29154061 frame shift probably null
R2273:Setx UTSW 2 29154061 frame shift probably null
R2274:Setx UTSW 2 29154061 frame shift probably null
R2275:Setx UTSW 2 29154061 frame shift probably null
R2309:Setx UTSW 2 29158904 missense probably damaging 1.00
R2328:Setx UTSW 2 29154060 frame shift probably null
R2328:Setx UTSW 2 29154061 frame shift probably null
R2329:Setx UTSW 2 29154061 frame shift probably null
R2331:Setx UTSW 2 29154061 frame shift probably null
R2332:Setx UTSW 2 29154061 frame shift probably null
R2429:Setx UTSW 2 29179898 missense probably benign 0.00
R2438:Setx UTSW 2 29154061 frame shift probably null
R2439:Setx UTSW 2 29154061 frame shift probably null
R2496:Setx UTSW 2 29144801 missense probably benign 0.11
R2858:Setx UTSW 2 29154061 frame shift probably null
R2859:Setx UTSW 2 29154061 frame shift probably null
R2884:Setx UTSW 2 29148625 missense probably damaging 0.98
R2885:Setx UTSW 2 29148625 missense probably damaging 0.98
R2886:Setx UTSW 2 29148625 missense probably damaging 0.98
R2915:Setx UTSW 2 29172324 missense probably damaging 0.99
R2921:Setx UTSW 2 29154060 small deletion probably benign
R2921:Setx UTSW 2 29154061 frame shift probably null
R2923:Setx UTSW 2 29154061 frame shift probably null
R3426:Setx UTSW 2 29154061 frame shift probably null
R3609:Setx UTSW 2 29154061 frame shift probably null
R3610:Setx UTSW 2 29154061 frame shift probably null
R3731:Setx UTSW 2 29154061 frame shift probably null
R3813:Setx UTSW 2 29154061 frame shift probably null
R3835:Setx UTSW 2 29145060 missense possibly damaging 0.81
R3871:Setx UTSW 2 29145741 missense probably damaging 0.98
R4013:Setx UTSW 2 29154061 frame shift probably null
R4014:Setx UTSW 2 29154061 frame shift probably null
R4015:Setx UTSW 2 29154061 frame shift probably null
R4017:Setx UTSW 2 29154061 frame shift probably null
R4246:Setx UTSW 2 29154061 frame shift probably null
R4248:Setx UTSW 2 29154061 frame shift probably null
R4297:Setx UTSW 2 29154061 frame shift probably null
R4298:Setx UTSW 2 29154061 frame shift probably null
R4539:Setx UTSW 2 29179748 missense probably benign 0.14
R4590:Setx UTSW 2 29144809 missense probably damaging 1.00
R4632:Setx UTSW 2 29148615 missense probably benign 0.23
R4782:Setx UTSW 2 29144046 missense probably damaging 0.99
R4801:Setx UTSW 2 29146373 missense probably benign 0.14
R4802:Setx UTSW 2 29146373 missense probably benign 0.14
R4975:Setx UTSW 2 29164550 missense probably damaging 1.00
R5040:Setx UTSW 2 29139338 missense probably damaging 1.00
R5133:Setx UTSW 2 29180081 missense probably benign 0.02
R5208:Setx UTSW 2 29166367 missense possibly damaging 0.63
R5237:Setx UTSW 2 29146983 missense probably benign 0.00
R5248:Setx UTSW 2 29148418 missense probably benign 0.26
R5288:Setx UTSW 2 29134033 critical splice donor site probably null
R5385:Setx UTSW 2 29134033 critical splice donor site probably null
R5387:Setx UTSW 2 29147594 missense probably benign 0.00
R5407:Setx UTSW 2 29145474 missense probably benign 0.00
R5685:Setx UTSW 2 29171280 missense probably damaging 1.00
R6110:Setx UTSW 2 29140290 missense probably damaging 1.00
R6136:Setx UTSW 2 29148027 missense probably benign 0.01
R6310:Setx UTSW 2 29176935 missense possibly damaging 0.57
R6328:Setx UTSW 2 29174462 intron probably benign
R6358:Setx UTSW 2 29171348 missense possibly damaging 0.79
R6384:Setx UTSW 2 29173558 missense probably damaging 1.00
R6400:Setx UTSW 2 29130274 missense probably damaging 0.97
R6572:Setx UTSW 2 29173694 missense possibly damaging 0.63
R6662:Setx UTSW 2 29158114 missense probably damaging 0.97
R6898:Setx UTSW 2 29148108 missense probably benign 0.00
R7188:Setx UTSW 2 29148172 missense probably benign 0.02
R7332:Setx UTSW 2 29146626 missense probably benign 0.00
R7357:Setx UTSW 2 29130301 missense probably benign 0.01
R7556:Setx UTSW 2 29146493 missense possibly damaging 0.88
R7646:Setx UTSW 2 29177549 missense possibly damaging 0.94
R7802:Setx UTSW 2 29147021 missense probably benign 0.02
R7810:Setx UTSW 2 29148651 missense probably benign 0.43
R7831:Setx UTSW 2 29157108 missense probably damaging 1.00
R7831:Setx UTSW 2 29179854 missense possibly damaging 0.75
R7850:Setx UTSW 2 29147418 missense probably damaging 1.00
R7858:Setx UTSW 2 29161550 missense probably damaging 1.00
R8121:Setx UTSW 2 29145034 missense possibly damaging 0.93
R8284:Setx UTSW 2 29145336 missense possibly damaging 0.46
R8301:Setx UTSW 2 29145690 missense possibly damaging 0.69
X0066:Setx UTSW 2 29147879 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCTGGGTGACATCTTTTCAGC -3'
(R):5'- GACGTTAGAGCACTTGCCTAG -3'

Sequencing Primer
(F):5'- GGTTTATTGGTTTAAACTTAGCTGAC -3'
(R):5'- GACGTTAGAGCACTTGCCTAGAATAC -3'
Posted On2019-12-20