Incidental Mutation 'R0083:Myh14'
ID60643
Institutional Source Beutler Lab
Gene Symbol Myh14
Ensembl Gene ENSMUSG00000030739
Gene Namemyosin, heavy polypeptide 14
SynonymsNMHC II-C, 2400004E04Rik
MMRRC Submission 038370-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0083 (G1)
Quality Score99
Status Validated
Chromosome7
Chromosomal Location44605803-44670843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44634519 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 654 (V654A)
Ref Sequence ENSEMBL: ENSMUSP00000046059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048102] [ENSMUST00000107899] [ENSMUST00000107900] [ENSMUST00000207775]
Predicted Effect probably damaging
Transcript: ENSMUST00000048102
AA Change: V654A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046059
Gene: ENSMUSG00000030739
AA Change: V654A

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Blast:MYSc 839 872 1e-12 BLAST
low complexity region 880 891 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1005 1013 N/A INTRINSIC
low complexity region 1021 1029 N/A INTRINSIC
low complexity region 1030 1041 N/A INTRINSIC
Pfam:Myosin_tail_1 1094 1951 9.3e-180 PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107899
AA Change: V646A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103531
Gene: ENSMUSG00000030739
AA Change: V646A

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 797 N/A SMART
IQ 798 820 3.91e-4 SMART
Blast:MYSc 831 864 1e-12 BLAST
low complexity region 872 883 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 997 1005 N/A INTRINSIC
low complexity region 1013 1021 N/A INTRINSIC
low complexity region 1022 1033 N/A INTRINSIC
Pfam:Myosin_tail_1 1086 1943 9e-180 PFAM
low complexity region 1947 1958 N/A INTRINSIC
low complexity region 1960 1989 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107900
AA Change: V654A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103532
Gene: ENSMUSG00000030739
AA Change: V654A

DomainStartEndE-ValueType
low complexity region 62 80 N/A INTRINSIC
MYSc 95 805 N/A SMART
IQ 806 828 3.91e-4 SMART
Pfam:Myosin_tail_1 869 1949 N/A PFAM
low complexity region 1955 1966 N/A INTRINSIC
low complexity region 1968 1997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207775
AA Change: V687A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208085
Predicted Effect unknown
Transcript: ENSMUST00000208200
AA Change: V332A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209024
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 83.1%
Validation Efficiency 88% (117/133)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-14 (MYO14). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene result in one form of autosomal dominant hearing impairment. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are healthy and survive to adulthood with no apparent defects. About 30% of knock-in mice either heterozygous or homozygous for a single amino acid mutation exhibit increased lymphoma incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A T 2: 85,494,132 F283L possibly damaging Het
4930562C15Rik A T 16: 4,849,542 I266F unknown Het
Adam39 T G 8: 40,825,078 F169V probably damaging Het
Adcy2 A T 13: 68,651,935 V858E probably damaging Het
Adgrv1 A G 13: 81,578,404 probably benign Het
Ankrd26 G T 6: 118,523,254 H1085Q probably benign Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atg4c C T 4: 99,221,440 H215Y possibly damaging Het
Atp6v0d2 G A 4: 19,880,001 probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
C1qtnf3 G A 15: 10,975,632 V175I possibly damaging Het
Cacna1c A G 6: 118,625,523 M1293T probably damaging Het
Ccdc88a T A 11: 29,503,463 S337T probably damaging Het
Cntn4 A G 6: 106,525,369 I362M possibly damaging Het
Col22a1 A T 15: 71,890,497 D104E possibly damaging Het
Col4a4 T C 1: 82,507,111 probably null Het
Cul7 C A 17: 46,655,556 R304S probably benign Het
Elfn2 A T 15: 78,673,414 L311Q probably damaging Het
Esrrb T C 12: 86,514,452 L320P probably damaging Het
Fbxw10 A G 11: 62,877,061 T903A probably benign Het
Fkbp4 G A 6: 128,432,407 probably benign Het
Gatad2b T A 3: 90,357,943 Y576N probably damaging Het
Greb1 T C 12: 16,696,451 M1273V probably benign Het
Helq C A 5: 100,768,368 E913* probably null Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Ints13 A G 6: 146,550,664 Y686H probably benign Het
Itgb7 C T 15: 102,223,482 R222H probably damaging Het
Krt81 A G 15: 101,463,465 I78T probably damaging Het
Lonp2 G A 8: 86,716,355 V815I probably benign Het
Mctp2 G T 7: 72,228,516 F271L possibly damaging Het
Mrto4 C T 4: 139,347,968 V175I possibly damaging Het
Neu2 A G 1: 87,597,262 Y323C probably damaging Het
Nt5dc1 A C 10: 34,403,764 M94R probably damaging Het
Nup210l A G 3: 90,189,575 T1364A probably damaging Het
Obscn T C 11: 59,022,374 D6939G probably damaging Het
Olfr1491 A T 19: 13,705,678 T284S probably damaging Het
Pias4 A G 10: 81,164,166 S18P probably damaging Het
Plcl1 A G 1: 55,697,939 Y813C possibly damaging Het
Plk5 G A 10: 80,356,662 G34S possibly damaging Het
Ptprj A T 2: 90,469,777 probably null Het
Rps6ka2 G A 17: 7,296,043 D617N probably benign Het
Sap130 C A 18: 31,666,329 probably benign Het
Sap130 C T 18: 31,711,641 P902S probably damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Sel1l3 C T 5: 53,137,902 A786T possibly damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc15a2 T C 16: 36,782,283 Y72C probably damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slc30a5 G T 13: 100,803,400 A669E probably damaging Het
Sppl2c G A 11: 104,186,532 V53I probably benign Het
Sstr1 T A 12: 58,213,742 C384S possibly damaging Het
Sulf1 A G 1: 12,817,417 M272V probably damaging Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Tmem94 A G 11: 115,796,724 probably benign Het
Topaz1 A T 9: 122,775,609 I1093L probably benign Het
Ttll4 G T 1: 74,679,769 V260L probably benign Het
Vmn2r26 A T 6: 124,053,981 probably null Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp939 A T 7: 39,474,110 noncoding transcript Het
Other mutations in Myh14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Myh14 APN 7 44606292 unclassified probably benign
IGL01431:Myh14 APN 7 44614358 missense probably null 0.00
IGL01722:Myh14 APN 7 44643532 missense probably damaging 1.00
IGL01806:Myh14 APN 7 44657939 missense probably benign 0.19
IGL02034:Myh14 APN 7 44616293 missense possibly damaging 0.58
IGL02260:Myh14 APN 7 44611571 missense probably damaging 1.00
IGL02590:Myh14 APN 7 44624079 missense probably damaging 1.00
IGL02696:Myh14 APN 7 44665106 missense probably damaging 1.00
IGL02705:Myh14 APN 7 44608536 missense possibly damaging 0.66
IGL03193:Myh14 APN 7 44629945 missense possibly damaging 0.91
PIT4581001:Myh14 UTSW 7 44613482 missense probably benign 0.04
R0067:Myh14 UTSW 7 44623127 missense probably benign 0.05
R0108:Myh14 UTSW 7 44634519 missense probably damaging 0.98
R0152:Myh14 UTSW 7 44623181 missense probably damaging 1.00
R0369:Myh14 UTSW 7 44660950 missense probably damaging 1.00
R0552:Myh14 UTSW 7 44613681 missense probably damaging 1.00
R0699:Myh14 UTSW 7 44624971 missense possibly damaging 0.67
R0763:Myh14 UTSW 7 44665367 missense probably damaging 0.98
R1079:Myh14 UTSW 7 44630002 missense probably damaging 1.00
R1388:Myh14 UTSW 7 44665122 missense probably damaging 0.98
R1432:Myh14 UTSW 7 44616299 missense probably damaging 1.00
R1568:Myh14 UTSW 7 44611698 nonsense probably null
R1579:Myh14 UTSW 7 44655694 splice site probably null
R1598:Myh14 UTSW 7 44638394 missense probably damaging 0.96
R1848:Myh14 UTSW 7 44632429 missense probably damaging 0.98
R1869:Myh14 UTSW 7 44611643 missense possibly damaging 0.95
R1917:Myh14 UTSW 7 44657925 missense probably benign
R1933:Myh14 UTSW 7 44615348 missense probably benign 0.09
R1984:Myh14 UTSW 7 44639022 missense probably damaging 1.00
R2154:Myh14 UTSW 7 44652429 critical splice donor site probably null
R2190:Myh14 UTSW 7 44661063 missense probably damaging 1.00
R2217:Myh14 UTSW 7 44634376 missense probably damaging 1.00
R2239:Myh14 UTSW 7 44665183 missense probably damaging 1.00
R2918:Myh14 UTSW 7 44616263 missense possibly damaging 0.91
R4091:Myh14 UTSW 7 44632991 missense possibly damaging 0.93
R4110:Myh14 UTSW 7 44628550 missense probably benign 0.00
R4199:Myh14 UTSW 7 44615503 nonsense probably null
R4507:Myh14 UTSW 7 44629991 missense probably benign 0.00
R4539:Myh14 UTSW 7 44627054 missense probably damaging 1.00
R4550:Myh14 UTSW 7 44634433 missense probably damaging 1.00
R4673:Myh14 UTSW 7 44624330 missense probably damaging 1.00
R4768:Myh14 UTSW 7 44613675 missense probably benign 0.19
R4832:Myh14 UTSW 7 44625142 missense probably benign 0.31
R4853:Myh14 UTSW 7 44608448 missense probably damaging 1.00
R4901:Myh14 UTSW 7 44661040 missense probably damaging 1.00
R4928:Myh14 UTSW 7 44635502 missense probably benign 0.00
R5070:Myh14 UTSW 7 44616248 missense possibly damaging 0.91
R5166:Myh14 UTSW 7 44628855 missense probably damaging 0.99
R5726:Myh14 UTSW 7 44643462 critical splice donor site probably null
R5786:Myh14 UTSW 7 44613463 missense probably benign 0.23
R5895:Myh14 UTSW 7 44606709 missense probably damaging 1.00
R5961:Myh14 UTSW 7 44623094 missense probably damaging 0.96
R6014:Myh14 UTSW 7 44625078 missense probably null
R6080:Myh14 UTSW 7 44655611 missense probably damaging 1.00
R6187:Myh14 UTSW 7 44627033 missense probably damaging 1.00
R6657:Myh14 UTSW 7 44637846 missense probably damaging 1.00
R6833:Myh14 UTSW 7 44624379 nonsense probably null
R6894:Myh14 UTSW 7 44633512 missense probably damaging 1.00
R6916:Myh14 UTSW 7 44629313 missense probably damaging 0.96
R6962:Myh14 UTSW 7 44657939 missense probably benign 0.36
R7066:Myh14 UTSW 7 44630755 missense possibly damaging 0.69
R7261:Myh14 UTSW 7 44624337 nonsense probably null
R7303:Myh14 UTSW 7 44611701 missense probably damaging 1.00
R7304:Myh14 UTSW 7 44629991 missense probably benign 0.00
R7327:Myh14 UTSW 7 44611553 missense possibly damaging 0.53
R7380:Myh14 UTSW 7 44661042 missense probably damaging 1.00
R7570:Myh14 UTSW 7 44632426 missense probably benign 0.37
R7622:Myh14 UTSW 7 44632422 missense probably benign 0.25
R7681:Myh14 UTSW 7 44624148 missense possibly damaging 0.81
R7718:Myh14 UTSW 7 44661040 missense probably damaging 1.00
R7910:Myh14 UTSW 7 44632395 missense probably damaging 1.00
R7991:Myh14 UTSW 7 44632395 missense probably damaging 1.00
R8054:Myh14 UTSW 7 44625127 missense probably damaging 0.97
X0026:Myh14 UTSW 7 44614394 missense probably benign 0.00
X0063:Myh14 UTSW 7 44624133 missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44608515 missense probably damaging 1.00
Z1176:Myh14 UTSW 7 44638309 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCGTGAGAACTCGATGTCCTCC -3'
(R):5'- TAGCAGTGCTCTGTGTGACATGCC -3'

Sequencing Primer
(F):5'- GTGGACACTCAGAAACTTTAGGTC -3'
(R):5'- TGTGACATGCCAGGTCCTATAAAC -3'
Posted On2013-07-24