Incidental Mutation 'R7843:Vmn2r72'
ID606443
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7843 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85749630 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 505 (T505I)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably benign
Transcript: ENSMUST00000063425
AA Change: T505I

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: T505I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 35,959,243 D641G possibly damaging Het
Adam1b A T 5: 121,501,437 I515N probably damaging Het
Adamtsl5 A G 10: 80,342,923 V207A probably damaging Het
Ampd3 A G 7: 110,791,188 I143V probably benign Het
Ank3 A T 10: 69,986,958 T486S probably benign Het
BC051142 C T 17: 34,449,824 T176I possibly damaging Het
Bcl11a A G 11: 24,164,831 I725V probably benign Het
Blmh A G 11: 76,946,313 N29D probably damaging Het
C6 T A 15: 4,808,404 V832D Het
Ccdc191 T A 16: 43,959,336 L777M probably damaging Het
Ccdc74a C G 16: 17,646,749 H45Q Het
Cenpe T A 3: 135,232,959 Y517* probably null Het
Cep290 G T 10: 100,516,188 R752L possibly damaging Het
Cers5 A T 15: 99,772,331 W17R unknown Het
Chpf T C 1: 75,478,287 probably benign Het
Chst5 C A 8: 111,890,572 A139S probably benign Het
Cpn1 T A 19: 43,986,158 D44V probably benign Het
Cstf1 T C 2: 172,378,000 Y344H probably damaging Het
D7Ertd443e A C 7: 134,349,095 M283R possibly damaging Het
Dclk1 T A 3: 55,255,877 V130D probably damaging Het
Dscam C T 16: 96,825,630 V360M probably damaging Het
Dvl2 A G 11: 70,008,786 N518S probably benign Het
Eif2ak2 T A 17: 78,868,774 K231N probably benign Het
Elovl4 T C 9: 83,788,271 R123G probably damaging Het
Ern2 A G 7: 122,173,708 V562A probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Gcc2 C A 10: 58,268,021 Q90K possibly damaging Het
Gnpda1 A T 18: 38,328,899 S282T probably benign Het
Gpatch1 G T 7: 35,281,454 H880Q unknown Het
Haus6 T C 4: 86,586,341 D471G possibly damaging Het
Hcfc1r1 G T 17: 23,674,656 E70* probably null Het
Ighv1-54 A G 12: 115,193,863 W55R probably damaging Het
Jam3 T C 9: 27,106,416 probably null Het
Klhdc7a A T 4: 139,966,844 V264E possibly damaging Het
Lrrc4c A T 2: 97,630,213 T395S probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast2 G T 4: 116,353,011 T186K probably damaging Het
Meig1 T A 2: 3,409,211 K84M probably damaging Het
Mep1b G T 18: 21,095,053 S571I probably damaging Het
Muc2 T G 7: 141,695,419 V507G probably benign Het
Nkx2-3 C A 19: 43,614,882 T309N probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1377 A T 11: 50,985,018 T106S probably benign Het
Olfr1463 A T 19: 13,234,537 N96Y possibly damaging Het
Olfr905 T C 9: 38,472,947 S67P probably damaging Het
Pla2r1 T G 2: 60,447,475 T835P possibly damaging Het
Ppil6 C T 10: 41,501,866 T191I probably benign Het
Rps6ka5 T C 12: 100,553,149 D735G possibly damaging Het
Setx T A 2: 29,173,569 N2292K probably damaging Het
Slc1a6 A T 10: 78,796,260 I307F probably damaging Het
Slc5a3 T A 16: 92,079,019 W655R probably benign Het
Slc9a1 T C 4: 133,370,442 probably benign Het
Sptbn1 A G 11: 30,154,320 V128A probably damaging Het
Tenm3 T A 8: 48,229,111 K2495* probably null Het
Tnni3k T A 3: 155,038,524 T64S probably damaging Het
Top1 T C 2: 160,714,256 V545A possibly damaging Het
Trabd A G 15: 89,081,954 D38G possibly damaging Het
Umad1 G A 6: 8,401,140 D70N unknown Het
Usp36 T C 11: 118,285,965 E9G probably damaging Het
Vmn2r53 A G 7: 12,582,099 S598P probably damaging Het
Vmn2r60 A T 7: 42,195,087 T625S probably benign Het
Vwce T A 19: 10,664,283 I791K probably benign Het
Wdr64 C A 1: 175,812,102 H1046N probably benign Het
Zdhhc4 A T 5: 143,320,276 D232E probably damaging Het
Zfp984 A T 4: 147,757,708 F51I probably damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R4995:Vmn2r72 UTSW 7 85738485 missense probably damaging 1.00
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 splice site probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
R7688:Vmn2r72 UTSW 7 85754890 missense probably benign 0.32
R7753:Vmn2r72 UTSW 7 85750626 missense probably damaging 1.00
R8157:Vmn2r72 UTSW 7 85751233 missense probably benign 0.09
R8254:Vmn2r72 UTSW 7 85751019 missense probably damaging 1.00
R8389:Vmn2r72 UTSW 7 85751960 missense probably damaging 0.99
R8444:Vmn2r72 UTSW 7 85738175 missense probably benign
Z1176:Vmn2r72 UTSW 7 85749191 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATGAAAGACCTGGTTTAACACAC -3'
(R):5'- TGGAGACCTAGTCAACATGAAC -3'

Sequencing Primer
(F):5'- GGTGGCGTACTCCTTTATACCCAG -3'
(R):5'- CCTAGTCAACATGAACCAGAATTTG -3'
Posted On2019-12-20