Incidental Mutation 'R7843:Muc2'
ID 606447
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 045897-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7843 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 141281662 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 507 (V507G)
Ref Sequence ENSEMBL: ENSMUSP00000141040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000167366
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179227
SMART Domains Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
C8 11 85 1.61e-32 SMART
Blast:VWD 102 128 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185406
AA Change: V507G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: V507G

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.5e-40 SMART
C8 216 290 3.9e-15 SMART
Pfam:TIL 293 349 5.4e-10 PFAM
VWC 351 411 7e-4 SMART
VWD 378 542 8.8e-44 SMART
C8 579 653 1.2e-36 SMART
SCOP:d1coua_ 654 728 4e-8 SMART
VWC_def 820 865 1.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185823
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 36,270,135 (GRCm39) D641G possibly damaging Het
Adam1b A T 5: 121,639,500 (GRCm39) I515N probably damaging Het
Adamtsl5 A G 10: 80,178,757 (GRCm39) V207A probably damaging Het
Ampd3 A G 7: 110,390,395 (GRCm39) I143V probably benign Het
Ank3 A T 10: 69,822,788 (GRCm39) T486S probably benign Het
Bcl11a A G 11: 24,114,831 (GRCm39) I725V probably benign Het
Blmh A G 11: 76,837,139 (GRCm39) N29D probably damaging Het
C6 T A 15: 4,837,886 (GRCm39) V832D Het
Ccdc191 T A 16: 43,779,699 (GRCm39) L777M probably damaging Het
Ccdc74a C G 16: 17,464,613 (GRCm39) H45Q Het
Cenpe T A 3: 134,938,720 (GRCm39) Y517* probably null Het
Cep290 G T 10: 100,352,050 (GRCm39) R752L possibly damaging Het
Cers5 A T 15: 99,670,212 (GRCm39) W17R unknown Het
Chpf T C 1: 75,454,931 (GRCm39) probably benign Het
Chst5 C A 8: 112,617,204 (GRCm39) A139S probably benign Het
Cpn1 T A 19: 43,974,597 (GRCm39) D44V probably benign Het
Cstf1 T C 2: 172,219,920 (GRCm39) Y344H probably damaging Het
D7Ertd443e A C 7: 133,950,824 (GRCm39) M283R possibly damaging Het
Dclk1 T A 3: 55,163,298 (GRCm39) V130D probably damaging Het
Dscam C T 16: 96,626,830 (GRCm39) V360M probably damaging Het
Dvl2 A G 11: 69,899,612 (GRCm39) N518S probably benign Het
Eif2ak2 T A 17: 79,176,203 (GRCm39) K231N probably benign Het
Elovl4 T C 9: 83,670,324 (GRCm39) R123G probably damaging Het
Ern2 A G 7: 121,772,931 (GRCm39) V562A probably damaging Het
F13a1 A T 13: 37,209,745 (GRCm39) N73K probably benign Het
Gcc2 C A 10: 58,103,843 (GRCm39) Q90K possibly damaging Het
Gnpda1 A T 18: 38,461,952 (GRCm39) S282T probably benign Het
Gpatch1 G T 7: 34,980,879 (GRCm39) H880Q unknown Het
Haus6 T C 4: 86,504,578 (GRCm39) D471G possibly damaging Het
Hcfc1r1 G T 17: 23,893,630 (GRCm39) E70* probably null Het
Ighv1-54 A G 12: 115,157,483 (GRCm39) W55R probably damaging Het
Jam3 T C 9: 27,017,712 (GRCm39) probably null Het
Klhdc7a A T 4: 139,694,155 (GRCm39) V264E possibly damaging Het
Lrrc4c A T 2: 97,460,558 (GRCm39) T395S probably benign Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Mast2 G T 4: 116,210,208 (GRCm39) T186K probably damaging Het
Meig1 T A 2: 3,410,248 (GRCm39) K84M probably damaging Het
Mep1b G T 18: 21,228,110 (GRCm39) S571I probably damaging Het
Nkx2-3 C A 19: 43,603,321 (GRCm39) T309N probably benign Het
Oaf G A 9: 43,134,077 (GRCm39) R215C probably damaging Het
Or1ad1 A T 11: 50,875,845 (GRCm39) T106S probably benign Het
Or5b109 A T 19: 13,211,901 (GRCm39) N96Y possibly damaging Het
Or8b1c T C 9: 38,384,243 (GRCm39) S67P probably damaging Het
Pla2r1 T G 2: 60,277,819 (GRCm39) T835P possibly damaging Het
Ppil6 C T 10: 41,377,862 (GRCm39) T191I probably benign Het
Rps6ka5 T C 12: 100,519,408 (GRCm39) D735G possibly damaging Het
Setx T A 2: 29,063,581 (GRCm39) N2292K probably damaging Het
Slc1a6 A T 10: 78,632,094 (GRCm39) I307F probably damaging Het
Slc5a3 T A 16: 91,875,907 (GRCm39) W655R probably benign Het
Slc9a1 T C 4: 133,097,753 (GRCm39) probably benign Het
Sptbn1 A G 11: 30,104,320 (GRCm39) V128A probably damaging Het
Tenm3 T A 8: 48,682,146 (GRCm39) K2495* probably null Het
Tnni3k T A 3: 154,744,161 (GRCm39) T64S probably damaging Het
Top1 T C 2: 160,556,176 (GRCm39) V545A possibly damaging Het
Trabd A G 15: 88,966,157 (GRCm39) D38G possibly damaging Het
Tsbp1 C T 17: 34,668,798 (GRCm39) T176I possibly damaging Het
Umad1 G A 6: 8,401,140 (GRCm39) D70N unknown Het
Usp36 T C 11: 118,176,791 (GRCm39) E9G probably damaging Het
Vmn2r53 A G 7: 12,316,026 (GRCm39) S598P probably damaging Het
Vmn2r60 A T 7: 41,844,511 (GRCm39) T625S probably benign Het
Vmn2r72 G A 7: 85,398,838 (GRCm39) T505I probably benign Het
Vwce T A 19: 10,641,647 (GRCm39) I791K probably benign Het
Wdr64 C A 1: 175,639,668 (GRCm39) H1046N probably benign Het
Zdhhc4 A T 5: 143,306,031 (GRCm39) D232E probably damaging Het
Zfp984 A T 4: 147,842,165 (GRCm39) F51I probably damaging Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CAGGCAGACTCTATTCTTGGG -3'
(R):5'- TGAAGTCATCACTCTCTAGGCC -3'

Sequencing Primer
(F):5'- GCAGACTCTATTCTTGGGTCCCTG -3'
(R):5'- GGCCATTGAAGTTTCCACAG -3'
Posted On 2019-12-20