Mutagenetix > Incidental Mutation

Incidental Mutation 'R7843:Muc2'

606447

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R7843 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 141695419 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 507 (V507G)

Ref Sequence

ENSEMBL: ENSMUSP00000141040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000167366

SMART Domains

Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	72	2.3e-14	PFAM
C8	107	181	1.82e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179227

SMART Domains

Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
C8	11	85	1.61e-32	SMART
Blast:VWD	102	128	5e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000185406
AA Change: V507G

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515
AA Change: V507G

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
VWD	20	183	1.5e-40	SMART
C8	216	290	3.9e-15	SMART
Pfam:TIL	293	349	5.4e-10	PFAM
VWC	351	411	7e-4	SMART
VWD	378	542	8.8e-44	SMART
C8	579	653	1.2e-36	SMART
SCOP:d1coua_	654	728	4e-8	SMART
VWC_def	820	865	1.3e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185823

SMART Domains

Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515

Domain	Start	End	E-Value	Type
Pfam:VWD	3	73	5.6e-14	PFAM
C8	108	182	1.4e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf1	T	C	17: 35,959,243	D641G	possibly damaging	Het
Adam1b	A	T	5: 121,501,437	I515N	probably damaging	Het
Adamtsl5	A	G	10: 80,342,923	V207A	probably damaging	Het
Ampd3	A	G	7: 110,791,188	I143V	probably benign	Het
Ank3	A	T	10: 69,986,958	T486S	probably benign	Het
BC051142	C	T	17: 34,449,824	T176I	possibly damaging	Het
Bcl11a	A	G	11: 24,164,831	I725V	probably benign	Het
Blmh	A	G	11: 76,946,313	N29D	probably damaging	Het
C6	T	A	15: 4,808,404	V832D		Het
Ccdc191	T	A	16: 43,959,336	L777M	probably damaging	Het
Ccdc74a	C	G	16: 17,646,749	H45Q		Het
Cenpe	T	A	3: 135,232,959	Y517*	probably null	Het
Cep290	G	T	10: 100,516,188	R752L	possibly damaging	Het
Cers5	A	T	15: 99,772,331	W17R	unknown	Het
Chpf	T	C	1: 75,478,287		probably benign	Het
Chst5	C	A	8: 111,890,572	A139S	probably benign	Het
Cpn1	T	A	19: 43,986,158	D44V	probably benign	Het
Cstf1	T	C	2: 172,378,000	Y344H	probably damaging	Het
D7Ertd443e	A	C	7: 134,349,095	M283R	possibly damaging	Het
Dclk1	T	A	3: 55,255,877	V130D	probably damaging	Het
Dscam	C	T	16: 96,825,630	V360M	probably damaging	Het
Dvl2	A	G	11: 70,008,786	N518S	probably benign	Het
Eif2ak2	T	A	17: 78,868,774	K231N	probably benign	Het
Elovl4	T	C	9: 83,788,271	R123G	probably damaging	Het
Ern2	A	G	7: 122,173,708	V562A	probably damaging	Het
F13a1	A	T	13: 37,025,771	N73K	probably benign	Het
Gcc2	C	A	10: 58,268,021	Q90K	possibly damaging	Het
Gnpda1	A	T	18: 38,328,899	S282T	probably benign	Het
Gpatch1	G	T	7: 35,281,454	H880Q	unknown	Het
Haus6	T	C	4: 86,586,341	D471G	possibly damaging	Het
Hcfc1r1	G	T	17: 23,674,656	E70*	probably null	Het
Ighv1-54	A	G	12: 115,193,863	W55R	probably damaging	Het
Jam3	T	C	9: 27,106,416		probably null	Het
Klhdc7a	A	T	4: 139,966,844	V264E	possibly damaging	Het
Lrrc4c	A	T	2: 97,630,213	T395S	probably benign	Het
Man2a2	G	C	7: 80,368,865	A82G	probably benign	Het
Mast2	G	T	4: 116,353,011	T186K	probably damaging	Het
Meig1	T	A	2: 3,409,211	K84M	probably damaging	Het
Mep1b	G	T	18: 21,095,053	S571I	probably damaging	Het
Nkx2-3	C	A	19: 43,614,882	T309N	probably benign	Het
Oaf	G	A	9: 43,222,780	R215C	probably damaging	Het
Olfr1377	A	T	11: 50,985,018	T106S	probably benign	Het
Olfr1463	A	T	19: 13,234,537	N96Y	possibly damaging	Het
Olfr905	T	C	9: 38,472,947	S67P	probably damaging	Het
Pla2r1	T	G	2: 60,447,475	T835P	possibly damaging	Het
Ppil6	C	T	10: 41,501,866	T191I	probably benign	Het
Rps6ka5	T	C	12: 100,553,149	D735G	possibly damaging	Het
Setx	T	A	2: 29,173,569	N2292K	probably damaging	Het
Slc1a6	A	T	10: 78,796,260	I307F	probably damaging	Het
Slc5a3	T	A	16: 92,079,019	W655R	probably benign	Het
Slc9a1	T	C	4: 133,370,442		probably benign	Het
Sptbn1	A	G	11: 30,154,320	V128A	probably damaging	Het
Tenm3	T	A	8: 48,229,111	K2495*	probably null	Het
Tnni3k	T	A	3: 155,038,524	T64S	probably damaging	Het
Top1	T	C	2: 160,714,256	V545A	possibly damaging	Het
Trabd	A	G	15: 89,081,954	D38G	possibly damaging	Het
Umad1	G	A	6: 8,401,140	D70N	unknown	Het
Usp36	T	C	11: 118,285,965	E9G	probably damaging	Het
Vmn2r53	A	G	7: 12,582,099	S598P	probably damaging	Het
Vmn2r60	A	T	7: 42,195,087	T625S	probably benign	Het
Vmn2r72	G	A	7: 85,749,630	T505I	probably benign	Het
Vwce	T	A	19: 10,664,283	I791K	probably benign	Het
Wdr64	C	A	1: 175,812,102	H1046N	probably benign	Het
Zdhhc4	A	T	5: 143,320,276	D232E	probably damaging	Het
Zfp984	A	T	4: 147,757,708	F51I	probably damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- CAGGCAGACTCTATTCTTGGG -3'
(R):5'- TGAAGTCATCACTCTCTAGGCC -3'

Sequencing Primer
(F):5'- GCAGACTCTATTCTTGGGTCCCTG -3'
(R):5'- GGCCATTGAAGTTTCCACAG -3'

Posted On

2019-12-20