Incidental Mutation 'R7843:Cep290'
ID 606459
Institutional Source Beutler Lab
Gene Symbol Cep290
Ensembl Gene ENSMUSG00000019971
Gene Name centrosomal protein 290
Synonyms Kiaa, Nphp6, b2b1752Clo, b2b1454Clo
MMRRC Submission 045897-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R7843 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 100323410-100409527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 100352050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 752 (R752L)
Ref Sequence ENSEMBL: ENSMUSP00000130899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164751] [ENSMUST00000219765] [ENSMUST00000220346]
AlphaFold Q6A078
Predicted Effect possibly damaging
Transcript: ENSMUST00000164751
AA Change: R752L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130899
Gene: ENSMUSG00000019971
AA Change: R752L

DomainStartEndE-ValueType
coiled coil region 59 298 N/A INTRINSIC
coiled coil region 319 566 N/A INTRINSIC
coiled coil region 598 662 N/A INTRINSIC
coiled coil region 697 754 N/A INTRINSIC
coiled coil region 780 875 N/A INTRINSIC
internal_repeat_2 884 894 1.1e-5 PROSPERO
coiled coil region 986 1028 N/A INTRINSIC
internal_repeat_2 1057 1067 1.1e-5 PROSPERO
coiled coil region 1071 1109 N/A INTRINSIC
low complexity region 1140 1156 N/A INTRINSIC
internal_repeat_1 1176 1206 8.72e-8 PROSPERO
coiled coil region 1221 1250 N/A INTRINSIC
Pfam:CEP209_CC5 1290 1417 3.8e-55 PFAM
low complexity region 1476 1493 N/A INTRINSIC
internal_repeat_1 1498 1525 8.72e-8 PROSPERO
coiled coil region 1535 1595 N/A INTRINSIC
coiled coil region 1624 1716 N/A INTRINSIC
coiled coil region 1776 2328 N/A INTRINSIC
low complexity region 2333 2347 N/A INTRINSIC
coiled coil region 2377 2453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219765
AA Change: R745L

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220346
AA Change: R752L

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice display mislocalization of ciliary and phototransduction proteins resulting in early-onset retinal degeneration. Heterotaxy with transposition of the great arteries (TGA), atrioventricular septal defect (AVSD), left bronchial isomerism, and hypoplastic spleen is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 36,270,135 (GRCm39) D641G possibly damaging Het
Adam1b A T 5: 121,639,500 (GRCm39) I515N probably damaging Het
Adamtsl5 A G 10: 80,178,757 (GRCm39) V207A probably damaging Het
Ampd3 A G 7: 110,390,395 (GRCm39) I143V probably benign Het
Ank3 A T 10: 69,822,788 (GRCm39) T486S probably benign Het
Bcl11a A G 11: 24,114,831 (GRCm39) I725V probably benign Het
Blmh A G 11: 76,837,139 (GRCm39) N29D probably damaging Het
C6 T A 15: 4,837,886 (GRCm39) V832D Het
Ccdc191 T A 16: 43,779,699 (GRCm39) L777M probably damaging Het
Ccdc74a C G 16: 17,464,613 (GRCm39) H45Q Het
Cenpe T A 3: 134,938,720 (GRCm39) Y517* probably null Het
Cers5 A T 15: 99,670,212 (GRCm39) W17R unknown Het
Chpf T C 1: 75,454,931 (GRCm39) probably benign Het
Chst5 C A 8: 112,617,204 (GRCm39) A139S probably benign Het
Cpn1 T A 19: 43,974,597 (GRCm39) D44V probably benign Het
Cstf1 T C 2: 172,219,920 (GRCm39) Y344H probably damaging Het
D7Ertd443e A C 7: 133,950,824 (GRCm39) M283R possibly damaging Het
Dclk1 T A 3: 55,163,298 (GRCm39) V130D probably damaging Het
Dscam C T 16: 96,626,830 (GRCm39) V360M probably damaging Het
Dvl2 A G 11: 69,899,612 (GRCm39) N518S probably benign Het
Eif2ak2 T A 17: 79,176,203 (GRCm39) K231N probably benign Het
Elovl4 T C 9: 83,670,324 (GRCm39) R123G probably damaging Het
Ern2 A G 7: 121,772,931 (GRCm39) V562A probably damaging Het
F13a1 A T 13: 37,209,745 (GRCm39) N73K probably benign Het
Gcc2 C A 10: 58,103,843 (GRCm39) Q90K possibly damaging Het
Gnpda1 A T 18: 38,461,952 (GRCm39) S282T probably benign Het
Gpatch1 G T 7: 34,980,879 (GRCm39) H880Q unknown Het
Haus6 T C 4: 86,504,578 (GRCm39) D471G possibly damaging Het
Hcfc1r1 G T 17: 23,893,630 (GRCm39) E70* probably null Het
Ighv1-54 A G 12: 115,157,483 (GRCm39) W55R probably damaging Het
Jam3 T C 9: 27,017,712 (GRCm39) probably null Het
Klhdc7a A T 4: 139,694,155 (GRCm39) V264E possibly damaging Het
Lrrc4c A T 2: 97,460,558 (GRCm39) T395S probably benign Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Mast2 G T 4: 116,210,208 (GRCm39) T186K probably damaging Het
Meig1 T A 2: 3,410,248 (GRCm39) K84M probably damaging Het
Mep1b G T 18: 21,228,110 (GRCm39) S571I probably damaging Het
Muc2 T G 7: 141,281,662 (GRCm39) V507G probably benign Het
Nkx2-3 C A 19: 43,603,321 (GRCm39) T309N probably benign Het
Oaf G A 9: 43,134,077 (GRCm39) R215C probably damaging Het
Or1ad1 A T 11: 50,875,845 (GRCm39) T106S probably benign Het
Or5b109 A T 19: 13,211,901 (GRCm39) N96Y possibly damaging Het
Or8b1c T C 9: 38,384,243 (GRCm39) S67P probably damaging Het
Pla2r1 T G 2: 60,277,819 (GRCm39) T835P possibly damaging Het
Ppil6 C T 10: 41,377,862 (GRCm39) T191I probably benign Het
Rps6ka5 T C 12: 100,519,408 (GRCm39) D735G possibly damaging Het
Setx T A 2: 29,063,581 (GRCm39) N2292K probably damaging Het
Slc1a6 A T 10: 78,632,094 (GRCm39) I307F probably damaging Het
Slc5a3 T A 16: 91,875,907 (GRCm39) W655R probably benign Het
Slc9a1 T C 4: 133,097,753 (GRCm39) probably benign Het
Sptbn1 A G 11: 30,104,320 (GRCm39) V128A probably damaging Het
Tenm3 T A 8: 48,682,146 (GRCm39) K2495* probably null Het
Tnni3k T A 3: 154,744,161 (GRCm39) T64S probably damaging Het
Top1 T C 2: 160,556,176 (GRCm39) V545A possibly damaging Het
Trabd A G 15: 88,966,157 (GRCm39) D38G possibly damaging Het
Tsbp1 C T 17: 34,668,798 (GRCm39) T176I possibly damaging Het
Umad1 G A 6: 8,401,140 (GRCm39) D70N unknown Het
Usp36 T C 11: 118,176,791 (GRCm39) E9G probably damaging Het
Vmn2r53 A G 7: 12,316,026 (GRCm39) S598P probably damaging Het
Vmn2r60 A T 7: 41,844,511 (GRCm39) T625S probably benign Het
Vmn2r72 G A 7: 85,398,838 (GRCm39) T505I probably benign Het
Vwce T A 19: 10,641,647 (GRCm39) I791K probably benign Het
Wdr64 C A 1: 175,639,668 (GRCm39) H1046N probably benign Het
Zdhhc4 A T 5: 143,306,031 (GRCm39) D232E probably damaging Het
Zfp984 A T 4: 147,842,165 (GRCm39) F51I probably damaging Het
Other mutations in Cep290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Cep290 APN 10 100,344,586 (GRCm39) missense probably benign 0.00
IGL00499:Cep290 APN 10 100,379,189 (GRCm39) missense probably damaging 1.00
IGL00547:Cep290 APN 10 100,346,570 (GRCm39) missense probably damaging 0.99
IGL00573:Cep290 APN 10 100,376,223 (GRCm39) missense probably damaging 1.00
IGL00646:Cep290 APN 10 100,337,016 (GRCm39) missense probably benign 0.15
IGL00755:Cep290 APN 10 100,366,966 (GRCm39) missense probably damaging 1.00
IGL00835:Cep290 APN 10 100,399,242 (GRCm39) nonsense probably null
IGL00846:Cep290 APN 10 100,376,195 (GRCm39) splice site probably benign
IGL00985:Cep290 APN 10 100,403,023 (GRCm39) splice site probably benign
IGL01687:Cep290 APN 10 100,336,067 (GRCm39) missense probably damaging 1.00
IGL01782:Cep290 APN 10 100,380,987 (GRCm39) nonsense probably null
IGL02010:Cep290 APN 10 100,397,207 (GRCm39) missense probably benign 0.00
IGL02010:Cep290 APN 10 100,344,569 (GRCm39) missense probably benign 0.39
IGL02036:Cep290 APN 10 100,393,962 (GRCm39) nonsense probably null
IGL02039:Cep290 APN 10 100,350,464 (GRCm39) critical splice donor site probably null
IGL02532:Cep290 APN 10 100,380,927 (GRCm39) missense probably benign 0.04
IGL02950:Cep290 APN 10 100,376,191 (GRCm39) splice site probably benign
IGL03105:Cep290 APN 10 100,387,686 (GRCm39) missense possibly damaging 0.66
IGL03179:Cep290 APN 10 100,403,950 (GRCm39) missense possibly damaging 0.60
IGL03271:Cep290 APN 10 100,373,663 (GRCm39) missense probably benign 0.09
IGL03401:Cep290 APN 10 100,336,127 (GRCm39) missense probably benign 0.27
PIT4687001:Cep290 UTSW 10 100,373,453 (GRCm39) missense probably benign 0.28
R0025:Cep290 UTSW 10 100,373,693 (GRCm39) missense probably damaging 1.00
R0127:Cep290 UTSW 10 100,372,787 (GRCm39) splice site probably benign
R0254:Cep290 UTSW 10 100,350,436 (GRCm39) missense probably benign 0.31
R0295:Cep290 UTSW 10 100,373,683 (GRCm39) missense probably damaging 0.99
R0371:Cep290 UTSW 10 100,354,426 (GRCm39) splice site probably benign
R0390:Cep290 UTSW 10 100,344,620 (GRCm39) missense probably benign 0.09
R0399:Cep290 UTSW 10 100,390,262 (GRCm39) splice site probably benign
R0413:Cep290 UTSW 10 100,359,176 (GRCm39) nonsense probably null
R0427:Cep290 UTSW 10 100,352,041 (GRCm39) missense probably benign 0.01
R0472:Cep290 UTSW 10 100,387,317 (GRCm39) missense probably benign 0.19
R0485:Cep290 UTSW 10 100,385,206 (GRCm39) missense possibly damaging 0.94
R0635:Cep290 UTSW 10 100,328,538 (GRCm39) missense probably damaging 1.00
R0675:Cep290 UTSW 10 100,404,675 (GRCm39) critical splice acceptor site probably null
R0972:Cep290 UTSW 10 100,354,624 (GRCm39) missense probably benign 0.08
R1238:Cep290 UTSW 10 100,353,725 (GRCm39) missense probably damaging 1.00
R1297:Cep290 UTSW 10 100,374,962 (GRCm39) splice site probably benign
R1368:Cep290 UTSW 10 100,330,828 (GRCm39) splice site probably benign
R1394:Cep290 UTSW 10 100,373,391 (GRCm39) missense possibly damaging 0.66
R1437:Cep290 UTSW 10 100,407,963 (GRCm39) missense probably benign 0.00
R1493:Cep290 UTSW 10 100,398,043 (GRCm39) missense probably benign 0.21
R1496:Cep290 UTSW 10 100,374,828 (GRCm39) missense probably damaging 1.00
R1539:Cep290 UTSW 10 100,332,690 (GRCm39) missense probably benign 0.06
R1598:Cep290 UTSW 10 100,385,191 (GRCm39) missense probably damaging 1.00
R1616:Cep290 UTSW 10 100,404,698 (GRCm39) missense probably benign
R1712:Cep290 UTSW 10 100,390,361 (GRCm39) missense probably benign 0.02
R1753:Cep290 UTSW 10 100,349,843 (GRCm39) missense probably benign
R1773:Cep290 UTSW 10 100,346,435 (GRCm39) missense probably benign
R1775:Cep290 UTSW 10 100,332,672 (GRCm39) missense probably damaging 0.98
R1799:Cep290 UTSW 10 100,352,058 (GRCm39) missense probably benign 0.00
R1937:Cep290 UTSW 10 100,333,815 (GRCm39) missense possibly damaging 0.71
R1991:Cep290 UTSW 10 100,367,046 (GRCm39) missense possibly damaging 0.80
R2031:Cep290 UTSW 10 100,348,262 (GRCm39) critical splice donor site probably null
R2164:Cep290 UTSW 10 100,354,657 (GRCm39) missense probably damaging 0.96
R2393:Cep290 UTSW 10 100,397,100 (GRCm39) critical splice acceptor site probably null
R2403:Cep290 UTSW 10 100,373,299 (GRCm39) missense probably benign 0.19
R3612:Cep290 UTSW 10 100,377,443 (GRCm39) nonsense probably null
R3800:Cep290 UTSW 10 100,408,803 (GRCm39) missense probably damaging 0.97
R4005:Cep290 UTSW 10 100,374,870 (GRCm39) missense probably damaging 1.00
R4039:Cep290 UTSW 10 100,348,263 (GRCm39) critical splice donor site probably null
R4259:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4260:Cep290 UTSW 10 100,350,354 (GRCm39) missense probably damaging 1.00
R4319:Cep290 UTSW 10 100,374,909 (GRCm39) missense probably benign 0.09
R4329:Cep290 UTSW 10 100,373,530 (GRCm39) missense probably damaging 0.98
R4573:Cep290 UTSW 10 100,354,712 (GRCm39) missense probably benign
R4614:Cep290 UTSW 10 100,395,549 (GRCm39) missense possibly damaging 0.93
R4614:Cep290 UTSW 10 100,344,602 (GRCm39) missense probably benign
R4708:Cep290 UTSW 10 100,359,126 (GRCm39) missense probably benign 0.02
R4727:Cep290 UTSW 10 100,399,132 (GRCm39) missense probably benign 0.05
R4825:Cep290 UTSW 10 100,324,210 (GRCm39) missense probably damaging 0.96
R4839:Cep290 UTSW 10 100,344,648 (GRCm39) missense probably damaging 0.99
R4858:Cep290 UTSW 10 100,330,773 (GRCm39) missense probably benign 0.31
R4871:Cep290 UTSW 10 100,384,776 (GRCm39) missense probably benign 0.22
R5094:Cep290 UTSW 10 100,402,892 (GRCm39) missense probably damaging 0.97
R5103:Cep290 UTSW 10 100,374,882 (GRCm39) missense probably damaging 1.00
R5499:Cep290 UTSW 10 100,373,515 (GRCm39) missense probably damaging 0.99
R5505:Cep290 UTSW 10 100,335,048 (GRCm39) critical splice donor site probably null
R5615:Cep290 UTSW 10 100,367,012 (GRCm39) missense probably damaging 1.00
R5815:Cep290 UTSW 10 100,393,970 (GRCm39) missense possibly damaging 0.80
R5883:Cep290 UTSW 10 100,359,261 (GRCm39) missense probably benign 0.44
R5889:Cep290 UTSW 10 100,334,936 (GRCm39) missense possibly damaging 0.95
R5928:Cep290 UTSW 10 100,387,692 (GRCm39) missense probably damaging 0.99
R5992:Cep290 UTSW 10 100,379,183 (GRCm39) missense possibly damaging 0.73
R6000:Cep290 UTSW 10 100,377,649 (GRCm39) missense probably damaging 1.00
R6213:Cep290 UTSW 10 100,359,222 (GRCm39) missense probably benign 0.06
R6274:Cep290 UTSW 10 100,366,069 (GRCm39) missense probably damaging 1.00
R6285:Cep290 UTSW 10 100,359,191 (GRCm39) missense probably benign 0.17
R6306:Cep290 UTSW 10 100,367,028 (GRCm39) missense possibly damaging 0.89
R6593:Cep290 UTSW 10 100,344,638 (GRCm39) missense probably benign 0.01
R6649:Cep290 UTSW 10 100,354,393 (GRCm39) missense probably benign 0.28
R6692:Cep290 UTSW 10 100,405,006 (GRCm39) splice site probably null
R6788:Cep290 UTSW 10 100,324,490 (GRCm39) missense probably damaging 1.00
R6847:Cep290 UTSW 10 100,399,281 (GRCm39) missense probably damaging 1.00
R6947:Cep290 UTSW 10 100,365,918 (GRCm39) missense probably damaging 1.00
R7035:Cep290 UTSW 10 100,334,933 (GRCm39) missense probably benign 0.07
R7073:Cep290 UTSW 10 100,374,865 (GRCm39) missense possibly damaging 0.90
R7114:Cep290 UTSW 10 100,379,220 (GRCm39) missense probably damaging 0.98
R7256:Cep290 UTSW 10 100,382,360 (GRCm39) missense probably damaging 1.00
R7258:Cep290 UTSW 10 100,334,970 (GRCm39) missense probably benign 0.01
R7311:Cep290 UTSW 10 100,373,580 (GRCm39) missense probably damaging 0.98
R7505:Cep290 UTSW 10 100,352,127 (GRCm39) missense probably benign 0.01
R7615:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7643:Cep290 UTSW 10 100,373,415 (GRCm39) missense probably benign
R7662:Cep290 UTSW 10 100,373,665 (GRCm39) missense probably benign 0.21
R7663:Cep290 UTSW 10 100,390,398 (GRCm39) critical splice donor site probably null
R7685:Cep290 UTSW 10 100,375,919 (GRCm39) missense probably benign 0.19
R7699:Cep290 UTSW 10 100,376,231 (GRCm39) missense probably benign 0.33
R7717:Cep290 UTSW 10 100,328,543 (GRCm39) missense probably benign 0.03
R7747:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R7757:Cep290 UTSW 10 100,399,296 (GRCm39) missense probably benign
R7905:Cep290 UTSW 10 100,390,352 (GRCm39) missense probably benign
R8078:Cep290 UTSW 10 100,408,749 (GRCm39) missense probably benign 0.04
R8081:Cep290 UTSW 10 100,394,038 (GRCm39) nonsense probably null
R8094:Cep290 UTSW 10 100,380,793 (GRCm39) missense possibly damaging 0.95
R8266:Cep290 UTSW 10 100,395,533 (GRCm39) missense probably benign 0.08
R8305:Cep290 UTSW 10 100,380,796 (GRCm39) missense probably benign 0.09
R8325:Cep290 UTSW 10 100,353,670 (GRCm39) missense probably benign 0.03
R8372:Cep290 UTSW 10 100,385,203 (GRCm39) missense probably benign 0.00
R8443:Cep290 UTSW 10 100,331,706 (GRCm39) missense possibly damaging 0.80
R8497:Cep290 UTSW 10 100,387,320 (GRCm39) missense probably damaging 1.00
R8778:Cep290 UTSW 10 100,350,374 (GRCm39) nonsense probably null
R8975:Cep290 UTSW 10 100,349,782 (GRCm39) missense possibly damaging 0.54
R9146:Cep290 UTSW 10 100,377,665 (GRCm39) missense probably benign 0.44
R9264:Cep290 UTSW 10 100,333,878 (GRCm39) missense possibly damaging 0.86
R9374:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9448:Cep290 UTSW 10 100,395,546 (GRCm39) missense probably benign 0.32
R9499:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9507:Cep290 UTSW 10 100,330,785 (GRCm39) missense possibly damaging 0.81
R9539:Cep290 UTSW 10 100,404,713 (GRCm39) missense probably damaging 1.00
R9547:Cep290 UTSW 10 100,380,841 (GRCm39) missense probably benign 0.00
R9551:Cep290 UTSW 10 100,372,729 (GRCm39) missense probably damaging 0.98
R9657:Cep290 UTSW 10 100,351,003 (GRCm39) missense possibly damaging 0.93
R9731:Cep290 UTSW 10 100,346,404 (GRCm39) missense probably damaging 0.98
R9756:Cep290 UTSW 10 100,352,034 (GRCm39) missense probably damaging 0.97
R9777:Cep290 UTSW 10 100,354,529 (GRCm39) missense probably benign 0.01
Z1176:Cep290 UTSW 10 100,385,236 (GRCm39) critical splice donor site probably benign
Z1177:Cep290 UTSW 10 100,374,859 (GRCm39) missense possibly damaging 0.89
Z1177:Cep290 UTSW 10 100,333,806 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTCGGCTAAACATCCCAGC -3'
(R):5'- CAGTTTACACAGGAAAGGTTAGACG -3'

Sequencing Primer
(F):5'- TCTTTGCACTATAAAAGAGAAAGGG -3'
(R):5'- CAAGTTTACTTGCAAGCTTTTCTTG -3'
Posted On 2019-12-20