Incidental Mutation 'R7843:Usp36'
ID 606465
Institutional Source Beutler Lab
Gene Symbol Usp36
Ensembl Gene ENSMUSG00000033909
Gene Name ubiquitin specific peptidase 36
Synonyms 2700002L06Rik
MMRRC Submission 045897-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.960) question?
Stock # R7843 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 118150477-118181070 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 118176791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 9 (E9G)
Ref Sequence ENSEMBL: ENSMUSP00000090036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000144153]
AlphaFold B1AQJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000092382
AA Change: E9G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909
AA Change: E9G

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.6e-55 PFAM
Pfam:UCH_1 122 402 3.6e-26 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106296
AA Change: E9G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909
AA Change: E9G

DomainStartEndE-ValueType
Blast:NTR 1 29 3e-7 BLAST
Pfam:UCH 121 420 2.1e-49 PFAM
Pfam:UCH_1 122 402 2.2e-23 PFAM
low complexity region 540 558 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 744 763 N/A INTRINSIC
low complexity region 830 839 N/A INTRINSIC
low complexity region 889 899 N/A INTRINSIC
low complexity region 933 943 N/A INTRINSIC
low complexity region 1055 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144153
SMART Domains Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

DomainStartEndE-ValueType
Pfam:UCH 1 255 1e-40 PFAM
Pfam:UCH_1 4 237 2.9e-17 PFAM
low complexity region 375 393 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 513 528 N/A INTRINSIC
low complexity region 579 598 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 768 778 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 36,270,135 (GRCm39) D641G possibly damaging Het
Adam1b A T 5: 121,639,500 (GRCm39) I515N probably damaging Het
Adamtsl5 A G 10: 80,178,757 (GRCm39) V207A probably damaging Het
Ampd3 A G 7: 110,390,395 (GRCm39) I143V probably benign Het
Ank3 A T 10: 69,822,788 (GRCm39) T486S probably benign Het
Bcl11a A G 11: 24,114,831 (GRCm39) I725V probably benign Het
Blmh A G 11: 76,837,139 (GRCm39) N29D probably damaging Het
C6 T A 15: 4,837,886 (GRCm39) V832D Het
Ccdc191 T A 16: 43,779,699 (GRCm39) L777M probably damaging Het
Ccdc74a C G 16: 17,464,613 (GRCm39) H45Q Het
Cenpe T A 3: 134,938,720 (GRCm39) Y517* probably null Het
Cep290 G T 10: 100,352,050 (GRCm39) R752L possibly damaging Het
Cers5 A T 15: 99,670,212 (GRCm39) W17R unknown Het
Chpf T C 1: 75,454,931 (GRCm39) probably benign Het
Chst5 C A 8: 112,617,204 (GRCm39) A139S probably benign Het
Cpn1 T A 19: 43,974,597 (GRCm39) D44V probably benign Het
Cstf1 T C 2: 172,219,920 (GRCm39) Y344H probably damaging Het
D7Ertd443e A C 7: 133,950,824 (GRCm39) M283R possibly damaging Het
Dclk1 T A 3: 55,163,298 (GRCm39) V130D probably damaging Het
Dscam C T 16: 96,626,830 (GRCm39) V360M probably damaging Het
Dvl2 A G 11: 69,899,612 (GRCm39) N518S probably benign Het
Eif2ak2 T A 17: 79,176,203 (GRCm39) K231N probably benign Het
Elovl4 T C 9: 83,670,324 (GRCm39) R123G probably damaging Het
Ern2 A G 7: 121,772,931 (GRCm39) V562A probably damaging Het
F13a1 A T 13: 37,209,745 (GRCm39) N73K probably benign Het
Gcc2 C A 10: 58,103,843 (GRCm39) Q90K possibly damaging Het
Gnpda1 A T 18: 38,461,952 (GRCm39) S282T probably benign Het
Gpatch1 G T 7: 34,980,879 (GRCm39) H880Q unknown Het
Haus6 T C 4: 86,504,578 (GRCm39) D471G possibly damaging Het
Hcfc1r1 G T 17: 23,893,630 (GRCm39) E70* probably null Het
Ighv1-54 A G 12: 115,157,483 (GRCm39) W55R probably damaging Het
Jam3 T C 9: 27,017,712 (GRCm39) probably null Het
Klhdc7a A T 4: 139,694,155 (GRCm39) V264E possibly damaging Het
Lrrc4c A T 2: 97,460,558 (GRCm39) T395S probably benign Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Mast2 G T 4: 116,210,208 (GRCm39) T186K probably damaging Het
Meig1 T A 2: 3,410,248 (GRCm39) K84M probably damaging Het
Mep1b G T 18: 21,228,110 (GRCm39) S571I probably damaging Het
Muc2 T G 7: 141,281,662 (GRCm39) V507G probably benign Het
Nkx2-3 C A 19: 43,603,321 (GRCm39) T309N probably benign Het
Oaf G A 9: 43,134,077 (GRCm39) R215C probably damaging Het
Or1ad1 A T 11: 50,875,845 (GRCm39) T106S probably benign Het
Or5b109 A T 19: 13,211,901 (GRCm39) N96Y possibly damaging Het
Or8b1c T C 9: 38,384,243 (GRCm39) S67P probably damaging Het
Pla2r1 T G 2: 60,277,819 (GRCm39) T835P possibly damaging Het
Ppil6 C T 10: 41,377,862 (GRCm39) T191I probably benign Het
Rps6ka5 T C 12: 100,519,408 (GRCm39) D735G possibly damaging Het
Setx T A 2: 29,063,581 (GRCm39) N2292K probably damaging Het
Slc1a6 A T 10: 78,632,094 (GRCm39) I307F probably damaging Het
Slc5a3 T A 16: 91,875,907 (GRCm39) W655R probably benign Het
Slc9a1 T C 4: 133,097,753 (GRCm39) probably benign Het
Sptbn1 A G 11: 30,104,320 (GRCm39) V128A probably damaging Het
Tenm3 T A 8: 48,682,146 (GRCm39) K2495* probably null Het
Tnni3k T A 3: 154,744,161 (GRCm39) T64S probably damaging Het
Top1 T C 2: 160,556,176 (GRCm39) V545A possibly damaging Het
Trabd A G 15: 88,966,157 (GRCm39) D38G possibly damaging Het
Tsbp1 C T 17: 34,668,798 (GRCm39) T176I possibly damaging Het
Umad1 G A 6: 8,401,140 (GRCm39) D70N unknown Het
Vmn2r53 A G 7: 12,316,026 (GRCm39) S598P probably damaging Het
Vmn2r60 A T 7: 41,844,511 (GRCm39) T625S probably benign Het
Vmn2r72 G A 7: 85,398,838 (GRCm39) T505I probably benign Het
Vwce T A 19: 10,641,647 (GRCm39) I791K probably benign Het
Wdr64 C A 1: 175,639,668 (GRCm39) H1046N probably benign Het
Zdhhc4 A T 5: 143,306,031 (GRCm39) D232E probably damaging Het
Zfp984 A T 4: 147,842,165 (GRCm39) F51I probably damaging Het
Other mutations in Usp36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Usp36 APN 11 118,155,646 (GRCm39) missense possibly damaging 0.76
IGL01115:Usp36 APN 11 118,176,786 (GRCm39) missense probably damaging 1.00
IGL01720:Usp36 APN 11 118,165,828 (GRCm39) missense probably damaging 0.99
IGL02410:Usp36 APN 11 118,167,011 (GRCm39) missense probably damaging 1.00
IGL02700:Usp36 APN 11 118,166,983 (GRCm39) missense possibly damaging 0.95
IGL02926:Usp36 APN 11 118,155,609 (GRCm39) missense probably benign 0.22
IGL03145:Usp36 APN 11 118,170,067 (GRCm39) missense probably damaging 1.00
IGL03203:Usp36 APN 11 118,176,636 (GRCm39) missense probably benign 0.42
IGL03265:Usp36 APN 11 118,155,635 (GRCm39) missense possibly damaging 0.65
R0482:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R0499:Usp36 UTSW 11 118,164,397 (GRCm39) missense probably damaging 0.98
R0606:Usp36 UTSW 11 118,153,854 (GRCm39) splice site probably benign
R0646:Usp36 UTSW 11 118,163,847 (GRCm39) missense probably damaging 1.00
R1579:Usp36 UTSW 11 118,175,771 (GRCm39) missense probably damaging 1.00
R1646:Usp36 UTSW 11 118,164,392 (GRCm39) missense probably damaging 1.00
R1716:Usp36 UTSW 11 118,162,957 (GRCm39) critical splice donor site probably null
R1886:Usp36 UTSW 11 118,163,784 (GRCm39) missense probably damaging 1.00
R2014:Usp36 UTSW 11 118,153,334 (GRCm39) splice site probably benign
R2068:Usp36 UTSW 11 118,165,844 (GRCm39) missense possibly damaging 0.80
R2146:Usp36 UTSW 11 118,159,491 (GRCm39) missense probably benign 0.02
R2191:Usp36 UTSW 11 118,175,849 (GRCm39) missense possibly damaging 0.95
R2899:Usp36 UTSW 11 118,167,582 (GRCm39) splice site probably benign
R3176:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3177:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3276:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3277:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3615:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3616:Usp36 UTSW 11 118,167,585 (GRCm39) critical splice donor site probably null
R3768:Usp36 UTSW 11 118,153,878 (GRCm39) missense probably damaging 1.00
R3899:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R3900:Usp36 UTSW 11 118,170,650 (GRCm39) missense possibly damaging 0.90
R4484:Usp36 UTSW 11 118,176,621 (GRCm39) missense probably damaging 0.99
R4809:Usp36 UTSW 11 118,153,896 (GRCm39) missense probably damaging 1.00
R5135:Usp36 UTSW 11 118,155,731 (GRCm39) missense possibly damaging 0.58
R5323:Usp36 UTSW 11 118,156,020 (GRCm39) missense probably benign 0.21
R6226:Usp36 UTSW 11 118,168,100 (GRCm39) missense probably damaging 1.00
R6266:Usp36 UTSW 11 118,159,411 (GRCm39) missense probably damaging 1.00
R7191:Usp36 UTSW 11 118,159,660 (GRCm39) missense probably benign 0.39
R7215:Usp36 UTSW 11 118,155,980 (GRCm39) missense possibly damaging 0.87
R7289:Usp36 UTSW 11 118,164,355 (GRCm39) missense probably damaging 1.00
R7535:Usp36 UTSW 11 118,152,872 (GRCm39) missense possibly damaging 0.92
R7675:Usp36 UTSW 11 118,154,522 (GRCm39) missense probably benign 0.11
R8228:Usp36 UTSW 11 118,155,716 (GRCm39) missense possibly damaging 0.77
R8902:Usp36 UTSW 11 118,165,840 (GRCm39) missense probably damaging 1.00
R8935:Usp36 UTSW 11 118,167,657 (GRCm39) critical splice acceptor site probably null
R8995:Usp36 UTSW 11 118,175,825 (GRCm39) missense probably damaging 1.00
R9024:Usp36 UTSW 11 118,166,983 (GRCm39) missense possibly damaging 0.95
R9325:Usp36 UTSW 11 118,160,031 (GRCm39) missense possibly damaging 0.69
R9529:Usp36 UTSW 11 118,159,461 (GRCm39) nonsense probably null
R9774:Usp36 UTSW 11 118,153,875 (GRCm39) missense probably damaging 1.00
X0020:Usp36 UTSW 11 118,164,439 (GRCm39) missense probably damaging 1.00
Z1177:Usp36 UTSW 11 118,167,026 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGCCTGGAGTTCATC -3'
(R):5'- ATCACCACACGCAGAGTTG -3'

Sequencing Primer
(F):5'- GAGTTCATCTCCGCTCCTGTGG -3'
(R):5'- GCTTGCTGTGCATTTAGCTGC -3'
Posted On 2019-12-20