Incidental Mutation 'R7843:Ccdc191'
ID 606473
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock # R7843 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 43889800-43964314 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43959336 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 777 (L777M)
Ref Sequence ENSEMBL: ENSMUSP00000137597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect probably benign
Transcript: ENSMUST00000122440
AA Change: L362M

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701
AA Change: L362M

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132859
AA Change: L719M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: L719M

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178400
AA Change: L777M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: L777M

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 35,959,243 D641G possibly damaging Het
Adam1b A T 5: 121,501,437 I515N probably damaging Het
Adamtsl5 A G 10: 80,342,923 V207A probably damaging Het
Ampd3 A G 7: 110,791,188 I143V probably benign Het
Ank3 A T 10: 69,986,958 T486S probably benign Het
BC051142 C T 17: 34,449,824 T176I possibly damaging Het
Bcl11a A G 11: 24,164,831 I725V probably benign Het
Blmh A G 11: 76,946,313 N29D probably damaging Het
C6 T A 15: 4,808,404 V832D Het
Ccdc74a C G 16: 17,646,749 H45Q Het
Cenpe T A 3: 135,232,959 Y517* probably null Het
Cep290 G T 10: 100,516,188 R752L possibly damaging Het
Cers5 A T 15: 99,772,331 W17R unknown Het
Chpf T C 1: 75,478,287 probably benign Het
Chst5 C A 8: 111,890,572 A139S probably benign Het
Cpn1 T A 19: 43,986,158 D44V probably benign Het
Cstf1 T C 2: 172,378,000 Y344H probably damaging Het
D7Ertd443e A C 7: 134,349,095 M283R possibly damaging Het
Dclk1 T A 3: 55,255,877 V130D probably damaging Het
Dscam C T 16: 96,825,630 V360M probably damaging Het
Dvl2 A G 11: 70,008,786 N518S probably benign Het
Eif2ak2 T A 17: 78,868,774 K231N probably benign Het
Elovl4 T C 9: 83,788,271 R123G probably damaging Het
Ern2 A G 7: 122,173,708 V562A probably damaging Het
F13a1 A T 13: 37,025,771 N73K probably benign Het
Gcc2 C A 10: 58,268,021 Q90K possibly damaging Het
Gnpda1 A T 18: 38,328,899 S282T probably benign Het
Gpatch1 G T 7: 35,281,454 H880Q unknown Het
Haus6 T C 4: 86,586,341 D471G possibly damaging Het
Hcfc1r1 G T 17: 23,674,656 E70* probably null Het
Ighv1-54 A G 12: 115,193,863 W55R probably damaging Het
Jam3 T C 9: 27,106,416 probably null Het
Klhdc7a A T 4: 139,966,844 V264E possibly damaging Het
Lrrc4c A T 2: 97,630,213 T395S probably benign Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast2 G T 4: 116,353,011 T186K probably damaging Het
Meig1 T A 2: 3,409,211 K84M probably damaging Het
Mep1b G T 18: 21,095,053 S571I probably damaging Het
Muc2 T G 7: 141,695,419 V507G probably benign Het
Nkx2-3 C A 19: 43,614,882 T309N probably benign Het
Oaf G A 9: 43,222,780 R215C probably damaging Het
Olfr1377 A T 11: 50,985,018 T106S probably benign Het
Olfr1463 A T 19: 13,234,537 N96Y possibly damaging Het
Olfr905 T C 9: 38,472,947 S67P probably damaging Het
Pla2r1 T G 2: 60,447,475 T835P possibly damaging Het
Ppil6 C T 10: 41,501,866 T191I probably benign Het
Rps6ka5 T C 12: 100,553,149 D735G possibly damaging Het
Setx T A 2: 29,173,569 N2292K probably damaging Het
Slc1a6 A T 10: 78,796,260 I307F probably damaging Het
Slc5a3 T A 16: 92,079,019 W655R probably benign Het
Slc9a1 T C 4: 133,370,442 probably benign Het
Sptbn1 A G 11: 30,154,320 V128A probably damaging Het
Tenm3 T A 8: 48,229,111 K2495* probably null Het
Tnni3k T A 3: 155,038,524 T64S probably damaging Het
Top1 T C 2: 160,714,256 V545A possibly damaging Het
Trabd A G 15: 89,081,954 D38G possibly damaging Het
Umad1 G A 6: 8,401,140 D70N unknown Het
Usp36 T C 11: 118,285,965 E9G probably damaging Het
Vmn2r53 A G 7: 12,582,099 S598P probably damaging Het
Vmn2r60 A T 7: 42,195,087 T625S probably benign Het
Vmn2r72 G A 7: 85,749,630 T505I probably benign Het
Vwce T A 19: 10,664,283 I791K probably benign Het
Wdr64 C A 1: 175,812,102 H1046N probably benign Het
Zdhhc4 A T 5: 143,320,276 D232E probably damaging Het
Zfp984 A T 4: 147,757,708 F51I probably damaging Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43959300 missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43960022 missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43956894 missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43960099 missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43921801 intron probably benign
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0238:Ccdc191 UTSW 16 43947496 nonsense probably null
R0346:Ccdc191 UTSW 16 43938952 missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43931341 nonsense probably null
R0907:Ccdc191 UTSW 16 43915538 missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43931255 missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43943510 missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43908635 missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43931198 missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43943967 splice site probably null
R3104:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43931210 missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43947509 missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43931283 missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43939173 splice site probably benign
R4788:Ccdc191 UTSW 16 43956822 missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43943505 missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43908613 missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43915485 missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43947457 nonsense probably null
R7543:Ccdc191 UTSW 16 43898209 nonsense probably null
R8077:Ccdc191 UTSW 16 43915605 critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43889899 start gained probably benign
R8984:Ccdc191 UTSW 16 43890218 intron probably benign
R8987:Ccdc191 UTSW 16 43931347 missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43898149 missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43905468 missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43943678 nonsense probably null
R9448:Ccdc191 UTSW 16 43938975 missense
R9507:Ccdc191 UTSW 16 43943829 missense probably damaging 0.99
R9757:Ccdc191 UTSW 16 43941807 missense
Z1177:Ccdc191 UTSW 16 43939122 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGCCTGTCTAAACCTGCTACG -3'
(R):5'- GGCATTATCAAGCCCATTCAG -3'

Sequencing Primer
(F):5'- TGTCTAAACCTGCTACGTAGTATC -3'
(R):5'- AGCCCATTCAGCTTAGTTTTTG -3'
Posted On 2019-12-20