Incidental Mutation 'R7843:Ccdc191'
ID 606473
Institutional Source Beutler Lab
Gene Symbol Ccdc191
Ensembl Gene ENSMUSG00000022701
Gene Name coiled-coil domain containing 191
Synonyms 2610015P09Rik
MMRRC Submission 045897-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R7843 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 43710172-43784677 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43779699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 777 (L777M)
Ref Sequence ENSEMBL: ENSMUSP00000137597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132859] [ENSMUST00000178400]
AlphaFold J3QQ27
Predicted Effect probably benign
Transcript: ENSMUST00000122440
AA Change: L362M

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000113814
Gene: ENSMUSG00000022701
AA Change: L362M

DomainStartEndE-ValueType
coiled coil region 114 147 N/A INTRINSIC
coiled coil region 211 284 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132859
AA Change: L719M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116078
Gene: ENSMUSG00000022701
AA Change: L719M

DomainStartEndE-ValueType
coiled coil region 144 183 N/A INTRINSIC
coiled coil region 217 237 N/A INTRINSIC
coiled coil region 278 308 N/A INTRINSIC
low complexity region 349 368 N/A INTRINSIC
coiled coil region 471 504 N/A INTRINSIC
coiled coil region 568 641 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178400
AA Change: L777M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137597
Gene: ENSMUSG00000022701
AA Change: L777M

DomainStartEndE-ValueType
coiled coil region 202 241 N/A INTRINSIC
coiled coil region 275 295 N/A INTRINSIC
coiled coil region 336 366 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
coiled coil region 529 562 N/A INTRINSIC
coiled coil region 626 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 T C 17: 36,270,135 (GRCm39) D641G possibly damaging Het
Adam1b A T 5: 121,639,500 (GRCm39) I515N probably damaging Het
Adamtsl5 A G 10: 80,178,757 (GRCm39) V207A probably damaging Het
Ampd3 A G 7: 110,390,395 (GRCm39) I143V probably benign Het
Ank3 A T 10: 69,822,788 (GRCm39) T486S probably benign Het
Bcl11a A G 11: 24,114,831 (GRCm39) I725V probably benign Het
Blmh A G 11: 76,837,139 (GRCm39) N29D probably damaging Het
C6 T A 15: 4,837,886 (GRCm39) V832D Het
Ccdc74a C G 16: 17,464,613 (GRCm39) H45Q Het
Cenpe T A 3: 134,938,720 (GRCm39) Y517* probably null Het
Cep290 G T 10: 100,352,050 (GRCm39) R752L possibly damaging Het
Cers5 A T 15: 99,670,212 (GRCm39) W17R unknown Het
Chpf T C 1: 75,454,931 (GRCm39) probably benign Het
Chst5 C A 8: 112,617,204 (GRCm39) A139S probably benign Het
Cpn1 T A 19: 43,974,597 (GRCm39) D44V probably benign Het
Cstf1 T C 2: 172,219,920 (GRCm39) Y344H probably damaging Het
D7Ertd443e A C 7: 133,950,824 (GRCm39) M283R possibly damaging Het
Dclk1 T A 3: 55,163,298 (GRCm39) V130D probably damaging Het
Dscam C T 16: 96,626,830 (GRCm39) V360M probably damaging Het
Dvl2 A G 11: 69,899,612 (GRCm39) N518S probably benign Het
Eif2ak2 T A 17: 79,176,203 (GRCm39) K231N probably benign Het
Elovl4 T C 9: 83,670,324 (GRCm39) R123G probably damaging Het
Ern2 A G 7: 121,772,931 (GRCm39) V562A probably damaging Het
F13a1 A T 13: 37,209,745 (GRCm39) N73K probably benign Het
Gcc2 C A 10: 58,103,843 (GRCm39) Q90K possibly damaging Het
Gnpda1 A T 18: 38,461,952 (GRCm39) S282T probably benign Het
Gpatch1 G T 7: 34,980,879 (GRCm39) H880Q unknown Het
Haus6 T C 4: 86,504,578 (GRCm39) D471G possibly damaging Het
Hcfc1r1 G T 17: 23,893,630 (GRCm39) E70* probably null Het
Ighv1-54 A G 12: 115,157,483 (GRCm39) W55R probably damaging Het
Jam3 T C 9: 27,017,712 (GRCm39) probably null Het
Klhdc7a A T 4: 139,694,155 (GRCm39) V264E possibly damaging Het
Lrrc4c A T 2: 97,460,558 (GRCm39) T395S probably benign Het
Man2a2 G C 7: 80,018,613 (GRCm39) A82G probably benign Het
Mast2 G T 4: 116,210,208 (GRCm39) T186K probably damaging Het
Meig1 T A 2: 3,410,248 (GRCm39) K84M probably damaging Het
Mep1b G T 18: 21,228,110 (GRCm39) S571I probably damaging Het
Muc2 T G 7: 141,281,662 (GRCm39) V507G probably benign Het
Nkx2-3 C A 19: 43,603,321 (GRCm39) T309N probably benign Het
Oaf G A 9: 43,134,077 (GRCm39) R215C probably damaging Het
Or1ad1 A T 11: 50,875,845 (GRCm39) T106S probably benign Het
Or5b109 A T 19: 13,211,901 (GRCm39) N96Y possibly damaging Het
Or8b1c T C 9: 38,384,243 (GRCm39) S67P probably damaging Het
Pla2r1 T G 2: 60,277,819 (GRCm39) T835P possibly damaging Het
Ppil6 C T 10: 41,377,862 (GRCm39) T191I probably benign Het
Rps6ka5 T C 12: 100,519,408 (GRCm39) D735G possibly damaging Het
Setx T A 2: 29,063,581 (GRCm39) N2292K probably damaging Het
Slc1a6 A T 10: 78,632,094 (GRCm39) I307F probably damaging Het
Slc5a3 T A 16: 91,875,907 (GRCm39) W655R probably benign Het
Slc9a1 T C 4: 133,097,753 (GRCm39) probably benign Het
Sptbn1 A G 11: 30,104,320 (GRCm39) V128A probably damaging Het
Tenm3 T A 8: 48,682,146 (GRCm39) K2495* probably null Het
Tnni3k T A 3: 154,744,161 (GRCm39) T64S probably damaging Het
Top1 T C 2: 160,556,176 (GRCm39) V545A possibly damaging Het
Trabd A G 15: 88,966,157 (GRCm39) D38G possibly damaging Het
Tsbp1 C T 17: 34,668,798 (GRCm39) T176I possibly damaging Het
Umad1 G A 6: 8,401,140 (GRCm39) D70N unknown Het
Usp36 T C 11: 118,176,791 (GRCm39) E9G probably damaging Het
Vmn2r53 A G 7: 12,316,026 (GRCm39) S598P probably damaging Het
Vmn2r60 A T 7: 41,844,511 (GRCm39) T625S probably benign Het
Vmn2r72 G A 7: 85,398,838 (GRCm39) T505I probably benign Het
Vwce T A 19: 10,641,647 (GRCm39) I791K probably benign Het
Wdr64 C A 1: 175,639,668 (GRCm39) H1046N probably benign Het
Zdhhc4 A T 5: 143,306,031 (GRCm39) D232E probably damaging Het
Zfp984 A T 4: 147,842,165 (GRCm39) F51I probably damaging Het
Other mutations in Ccdc191
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Ccdc191 APN 16 43,779,663 (GRCm39) missense possibly damaging 0.81
IGL02272:Ccdc191 APN 16 43,780,385 (GRCm39) missense possibly damaging 0.85
IGL02473:Ccdc191 APN 16 43,777,257 (GRCm39) missense probably benign 0.03
IGL02660:Ccdc191 APN 16 43,780,462 (GRCm39) missense probably benign 0.11
LCD18:Ccdc191 UTSW 16 43,742,164 (GRCm39) intron probably benign
R0238:Ccdc191 UTSW 16 43,767,859 (GRCm39) nonsense probably null
R0238:Ccdc191 UTSW 16 43,767,859 (GRCm39) nonsense probably null
R0346:Ccdc191 UTSW 16 43,759,315 (GRCm39) missense probably damaging 0.99
R0590:Ccdc191 UTSW 16 43,751,704 (GRCm39) nonsense probably null
R0907:Ccdc191 UTSW 16 43,735,901 (GRCm39) missense probably benign 0.03
R0930:Ccdc191 UTSW 16 43,751,618 (GRCm39) missense probably damaging 1.00
R1761:Ccdc191 UTSW 16 43,763,873 (GRCm39) missense probably benign 0.01
R2127:Ccdc191 UTSW 16 43,728,998 (GRCm39) missense probably benign 0.00
R2408:Ccdc191 UTSW 16 43,751,561 (GRCm39) missense probably benign 0.08
R2567:Ccdc191 UTSW 16 43,764,330 (GRCm39) splice site probably null
R3104:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R3105:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R3106:Ccdc191 UTSW 16 43,751,573 (GRCm39) missense probably damaging 1.00
R4319:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4320:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4323:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4324:Ccdc191 UTSW 16 43,767,872 (GRCm39) missense probably damaging 1.00
R4667:Ccdc191 UTSW 16 43,751,646 (GRCm39) missense probably damaging 1.00
R4676:Ccdc191 UTSW 16 43,759,536 (GRCm39) splice site probably benign
R4788:Ccdc191 UTSW 16 43,777,185 (GRCm39) missense probably damaging 1.00
R4976:Ccdc191 UTSW 16 43,763,868 (GRCm39) missense probably benign 0.17
R5557:Ccdc191 UTSW 16 43,728,976 (GRCm39) missense probably damaging 1.00
R6369:Ccdc191 UTSW 16 43,735,848 (GRCm39) missense probably benign 0.05
R7459:Ccdc191 UTSW 16 43,767,820 (GRCm39) nonsense probably null
R7543:Ccdc191 UTSW 16 43,718,572 (GRCm39) nonsense probably null
R8077:Ccdc191 UTSW 16 43,735,968 (GRCm39) critical splice donor site probably null
R8474:Ccdc191 UTSW 16 43,710,262 (GRCm39) start gained probably benign
R8984:Ccdc191 UTSW 16 43,710,581 (GRCm39) intron probably benign
R8987:Ccdc191 UTSW 16 43,751,710 (GRCm39) missense probably benign 0.29
R9108:Ccdc191 UTSW 16 43,718,512 (GRCm39) missense possibly damaging 0.92
R9222:Ccdc191 UTSW 16 43,725,831 (GRCm39) missense probably damaging 1.00
R9276:Ccdc191 UTSW 16 43,764,041 (GRCm39) nonsense probably null
R9448:Ccdc191 UTSW 16 43,759,338 (GRCm39) missense
R9507:Ccdc191 UTSW 16 43,764,192 (GRCm39) missense probably damaging 0.99
R9757:Ccdc191 UTSW 16 43,762,170 (GRCm39) missense
Z1177:Ccdc191 UTSW 16 43,759,485 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TGCCTGTCTAAACCTGCTACG -3'
(R):5'- GGCATTATCAAGCCCATTCAG -3'

Sequencing Primer
(F):5'- TGTCTAAACCTGCTACGTAGTATC -3'
(R):5'- AGCCCATTCAGCTTAGTTTTTG -3'
Posted On 2019-12-20