Incidental Mutation 'R7844:Adora1'
ID606487
Institutional Source Beutler Lab
Gene Symbol Adora1
Ensembl Gene ENSMUSG00000042429
Gene Nameadenosine A1 receptor
SynonymsRi, A1AR, A1R, A1-AR, AA1R
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location134199223-134235431 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134203538 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 132 (W132R)
Ref Sequence ENSEMBL: ENSMUSP00000043522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038191] [ENSMUST00000038445] [ENSMUST00000086465] [ENSMUST00000169927] [ENSMUST00000187631] [ENSMUST00000191577]
Predicted Effect probably damaging
Transcript: ENSMUST00000038191
AA Change: W132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043522
Gene: ENSMUSG00000042429
AA Change: W132R

DomainStartEndE-ValueType
Pfam:7tm_4 17 305 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 9.8e-52 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038445
SMART Domains Protein: ENSMUSP00000042195
Gene: ENSMUSG00000042451

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086465
AA Change: W132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083656
Gene: ENSMUSG00000042429
AA Change: W132R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169927
AA Change: W132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132105
Gene: ENSMUSG00000042429
AA Change: W132R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 20 303 5e-14 PFAM
Pfam:7tm_1 26 288 1.9e-63 PFAM
low complexity region 311 323 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187631
AA Change: W132R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140801
Gene: ENSMUSG00000042429
AA Change: W132R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 17 146 1.2e-4 PFAM
Pfam:7TM_GPCR_Srsx 20 148 1.6e-9 PFAM
Pfam:7tm_1 26 176 1.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191577
SMART Domains Protein: ENSMUSP00000141104
Gene: ENSMUSG00000042451

DomainStartEndE-ValueType
low complexity region 41 66 N/A INTRINSIC
FN3 77 160 4.84e-9 SMART
IG 187 270 9.78e-7 SMART
FN3 273 355 1.1e-7 SMART
IGc2 400 467 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an adenosine receptor that belongs to the G-protein coupled receptor 1 family. There are 3 types of adenosine receptors, each with a specific pattern of ligand binding and tissue distribution, and together they regulate a diverse set of physiologic functions. The type A1 receptors inhibit adenylyl cyclase, and play a role in the fertilization process. Animal studies also suggest a role for A1 receptors in kidney function and ethanol intoxication. Transcript variants with alternative splicing in the 5' UTR have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele exhibit allodynia, hyperalgesia, increased anxiety, and decreased hypoxic neuroprotection. Homozygotes for a different null allele show increased susceptibility to kidney reperfusion injury and absent tubuloglomerular feedback response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Adora1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Adora1 APN 1 134203213 missense probably damaging 1.00
IGL01641:Adora1 APN 1 134234114 missense probably damaging 1.00
IGL03025:Adora1 APN 1 134203069 missense probably damaging 1.00
R4378:Adora1 UTSW 1 134203210 missense probably damaging 0.96
R5248:Adora1 UTSW 1 134203486 missense possibly damaging 0.49
R5327:Adora1 UTSW 1 134203010 nonsense probably null
R5408:Adora1 UTSW 1 134203163 missense probably benign 0.02
R6810:Adora1 UTSW 1 134234039 missense probably damaging 1.00
R7927:Adora1 UTSW 1 134203538 missense probably damaging 1.00
X0028:Adora1 UTSW 1 134203576 missense probably damaging 0.99
Z1177:Adora1 UTSW 1 134203009 missense probably benign 0.00
Z1177:Adora1 UTSW 1 134234124 missense possibly damaging 0.64
Z1177:Adora1 UTSW 1 134234228 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GCTTGCGGATCAGGTAGAAG -3'
(R):5'- ACTCACTCTAGACCTTAGACGTG -3'

Sequencing Primer
(F):5'- CCTCCAGGTAGATAAGAACCATGAG -3'
(R):5'- CTCTAGACCTTAGACGTGTAGAAGC -3'
Posted On2019-12-20