Incidental Mutation 'R7844:Acox3'
ID606497
Institutional Source Beutler Lab
Gene Symbol Acox3
Ensembl Gene ENSMUSG00000029098
Gene Nameacyl-Coenzyme A oxidase 3, pristanoyl
SynonymsEST-s59, pristanoyl-CoA oxidase, PCOX
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location35583040-35615352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35607148 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 535 (Q535L)
Ref Sequence ENSEMBL: ENSMUSP00000063412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068563] [ENSMUST00000068947] [ENSMUST00000114237] [ENSMUST00000114238] [ENSMUST00000202266]
Predicted Effect probably benign
Transcript: ENSMUST00000068563
AA Change: Q535L

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000067178
Gene: ENSMUSG00000029098
AA Change: Q535L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 3e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 6e-9 PFAM
Pfam:ACOX 507 662 5.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000068947
AA Change: Q535L

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000063412
Gene: ENSMUSG00000029098
AA Change: Q535L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 8.7e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 5.5e-8 PFAM
Pfam:ACOX 510 690 6.4e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114237
AA Change: Q535L

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000109875
Gene: ENSMUSG00000029098
AA Change: Q535L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 213 5.7e-15 PFAM
Pfam:Acyl-CoA_dh_1 297 466 9.4e-9 PFAM
Pfam:ACOX 507 695 1.6e-50 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000109876
Gene: ENSMUSG00000029098
AA Change: Q535L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 198 309 1.4e-17 PFAM
Pfam:Acyl-CoA_dh_1 340 509 1.3e-7 PFAM
Pfam:ACOX 553 707 1.4e-45 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000202266
AA Change: Q535L

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144499
Gene: ENSMUSG00000029098
AA Change: Q535L

DomainStartEndE-ValueType
Pfam:Acyl-CoA_dh_M 155 266 4.5e-18 PFAM
Pfam:Acyl-CoA_dh_1 297 466 3.2e-8 PFAM
Pfam:ACOX 510 667 1.6e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-Coenzyme A oxidase 3 also know as pristanoyl -CoA oxidase (ACOX3)is involved in the desaturation of 2-methyl branched fatty acids in peroxisomes. Unlike the rat homolog, the human gene is expressed in very low amounts in liver such that its mRNA was undetectable by routine Northern-blot analysis or its product by immunoblotting or by enzyme activity measurements. However the human cDNA encoding a 700 amino acid protein with a peroxisomal targeting C-terminal tripeptide S-K-L was isolated and is thought to be expressed under special conditions such as specific developmental stages or in a tissue specific manner in tissues that have not yet been examined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Acox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01135:Acox3 APN 5 35588752 missense probably benign 0.02
IGL02118:Acox3 APN 5 35601521 missense possibly damaging 0.55
IGL02554:Acox3 APN 5 35608366 missense probably damaging 1.00
IGL03377:Acox3 APN 5 35594332 missense probably damaging 1.00
R1543:Acox3 UTSW 5 35603008 missense probably damaging 1.00
R1661:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1665:Acox3 UTSW 5 35603027 missense probably damaging 1.00
R1707:Acox3 UTSW 5 35601564 missense possibly damaging 0.87
R1725:Acox3 UTSW 5 35592172 missense probably benign 0.26
R1763:Acox3 UTSW 5 35608339 unclassified probably null
R1851:Acox3 UTSW 5 35609062 missense possibly damaging 0.72
R1923:Acox3 UTSW 5 35592115 missense possibly damaging 0.80
R2154:Acox3 UTSW 5 35605224 missense probably damaging 1.00
R2418:Acox3 UTSW 5 35604638 missense probably benign 0.21
R2892:Acox3 UTSW 5 35594317 missense probably damaging 1.00
R2893:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2894:Acox3 UTSW 5 35599848 missense probably benign 0.02
R2964:Acox3 UTSW 5 35605267 missense possibly damaging 0.81
R3431:Acox3 UTSW 5 35589216 missense possibly damaging 0.47
R3735:Acox3 UTSW 5 35611153 missense probably benign 0.02
R3736:Acox3 UTSW 5 35611153 missense probably benign 0.02
R4106:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4107:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4108:Acox3 UTSW 5 35601552 missense probably damaging 0.99
R4579:Acox3 UTSW 5 35604643 missense probably damaging 1.00
R4862:Acox3 UTSW 5 35589739 missense probably benign 0.22
R4903:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4949:Acox3 UTSW 5 35612106 missense probably benign 0.06
R4964:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R4966:Acox3 UTSW 5 35589736 missense probably damaging 1.00
R5170:Acox3 UTSW 5 35588625 missense probably benign 0.42
R5278:Acox3 UTSW 5 35588156 splice site probably benign
R5569:Acox3 UTSW 5 35603033 missense probably damaging 1.00
R5733:Acox3 UTSW 5 35605199 splice site probably null
R5741:Acox3 UTSW 5 35608324 missense probably benign 0.07
R6530:Acox3 UTSW 5 35588695 missense possibly damaging 0.65
R6580:Acox3 UTSW 5 35608403 missense probably damaging 1.00
R6736:Acox3 UTSW 5 35588854 critical splice donor site probably null
R6848:Acox3 UTSW 5 35592184 missense probably damaging 1.00
R7012:Acox3 UTSW 5 35612087 missense probably benign 0.14
R7233:Acox3 UTSW 5 35605297 missense probably benign 0.01
R7477:Acox3 UTSW 5 35592103 nonsense probably null
R7837:Acox3 UTSW 5 35611486 critical splice acceptor site probably null
R7920:Acox3 UTSW 5 35611486 critical splice acceptor site probably null
R7927:Acox3 UTSW 5 35607148 missense probably benign 0.05
Z1088:Acox3 UTSW 5 35588222 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCCTCTGTGACTGGGTTTC -3'
(R):5'- GTCCATGTTCTTACAGCCAACAC -3'

Sequencing Primer
(F):5'- GACTGGGTTTCCCTGCCTG -3'
(R):5'- GCAGCTACTACCTGGCAC -3'
Posted On2019-12-20