Incidental Mutation 'R7844:Tada3'
ID606503
Institutional Source Beutler Lab
Gene Symbol Tada3
Ensembl Gene ENSMUSG00000048930
Gene Nametranscriptional adaptor 3
SynonymsADA3, Tada3l, 1110004B19Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113366025-113377883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113370960 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 300 (R300H)
Ref Sequence ENSEMBL: ENSMUSP00000032410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032410] [ENSMUST00000043333] [ENSMUST00000099118]
Predicted Effect probably benign
Transcript: ENSMUST00000032410
AA Change: R300H

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032410
Gene: ENSMUSG00000048930
AA Change: R300H

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Pfam:Ada3 309 430 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043333
AA Change: R281H

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000043363
Gene: ENSMUSG00000048930
AA Change: R281H

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Pfam:Ada3 289 413 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099118
AA Change: R100H

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108736
Gene: ENSMUSG00000048930
AA Change: R100H

DomainStartEndE-ValueType
Pfam:Ada3 108 232 6.7e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 associated with impaired proliferation of trophoblast cells and absence of inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Tada3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Tada3 APN 6 113376012 missense probably benign 0.41
IGL03256:Tada3 APN 6 113375131 missense possibly damaging 0.83
R0208:Tada3 UTSW 6 113367007 missense probably damaging 1.00
R0542:Tada3 UTSW 6 113375214 missense probably damaging 0.99
R0698:Tada3 UTSW 6 113367007 missense probably damaging 1.00
R2120:Tada3 UTSW 6 113371015 missense possibly damaging 0.50
R4384:Tada3 UTSW 6 113370379 missense probably damaging 1.00
R7927:Tada3 UTSW 6 113370960 missense probably benign 0.05
Z1176:Tada3 UTSW 6 113375862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTGCTCAGCTCCAGTAG -3'
(R):5'- CTCTCTAGCCTGTGAAGACTG -3'

Sequencing Primer
(F):5'- ATCAGGTCTGGACAAAGCCTGC -3'
(R):5'- AAGACTGTCTGTGCCTGTCAGAG -3'
Posted On2019-12-20