Incidental Mutation 'R7844:Pirb'
ID606504
Institutional Source Beutler Lab
Gene Symbol Pirb
Ensembl Gene ENSMUSG00000058818
Gene Namepaired Ig-like receptor B
SynonymsLilrb3, Gp91
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3711409-3720391 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 3719411 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 144 (C144*)
Ref Sequence ENSEMBL: ENSMUSP00000077546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078451]
Predicted Effect probably null
Transcript: ENSMUST00000078451
AA Change: C144*
SMART Domains Protein: ENSMUSP00000077546
Gene: ENSMUSG00000058818
AA Change: C144*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 34 118 1.8e-3 SMART
IG 129 315 1.2e-4 SMART
IG_like 237 302 6.2e-4 SMART
IG_like 328 415 3.4e-2 SMART
IG_like 435 502 1e-2 SMART
IG 529 618 3.6e-5 SMART
low complexity region 624 637 N/A INTRINSIC
transmembrane domain 641 663 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in both B and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Pirb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pirb APN 7 3717406 missense probably damaging 0.99
IGL01744:Pirb APN 7 3717176 nonsense probably null
IGL01755:Pirb APN 7 3717170 missense probably benign 0.16
IGL02580:Pirb APN 7 3714206 splice site probably null
IGL02941:Pirb APN 7 3717378 missense probably damaging 1.00
R0394:Pirb UTSW 7 3719248 missense probably benign 0.08
R0680:Pirb UTSW 7 3717361 missense possibly damaging 0.94
R0787:Pirb UTSW 7 3717638 missense probably benign
R0790:Pirb UTSW 7 3717638 missense probably benign
R0832:Pirb UTSW 7 3717638 missense probably benign
R1124:Pirb UTSW 7 3719732 missense probably benign 0.02
R1178:Pirb UTSW 7 3717638 missense probably benign
R1180:Pirb UTSW 7 3717638 missense probably benign
R1181:Pirb UTSW 7 3717638 missense probably benign
R1281:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1343:Pirb UTSW 7 3717638 missense probably benign
R1579:Pirb UTSW 7 3717638 missense probably benign
R1699:Pirb UTSW 7 3717638 missense probably benign
R1768:Pirb UTSW 7 3717190 missense probably damaging 1.00
R1909:Pirb UTSW 7 3714588 missense probably benign 0.33
R1965:Pirb UTSW 7 3717638 missense probably benign
R1966:Pirb UTSW 7 3717638 missense probably benign
R2004:Pirb UTSW 7 3717638 missense probably benign
R2305:Pirb UTSW 7 3712991 missense probably benign 0.00
R2931:Pirb UTSW 7 3717206 missense probably benign 0.08
R3858:Pirb UTSW 7 3717663 missense possibly damaging 0.54
R3928:Pirb UTSW 7 3717638 missense probably benign
R3938:Pirb UTSW 7 3717638 missense probably benign
R4119:Pirb UTSW 7 3717575 missense probably damaging 1.00
R4174:Pirb UTSW 7 3716032 critical splice donor site probably null
R4248:Pirb UTSW 7 3719298 missense probably damaging 1.00
R4827:Pirb UTSW 7 3717603 missense probably benign
R4828:Pirb UTSW 7 3717603 missense probably benign
R4829:Pirb UTSW 7 3717603 missense probably benign
R4830:Pirb UTSW 7 3717603 missense probably benign
R4870:Pirb UTSW 7 3712662 missense probably benign 0.00
R4909:Pirb UTSW 7 3719362 nonsense probably null
R5146:Pirb UTSW 7 3712621 utr 3 prime probably benign
R5244:Pirb UTSW 7 3716063 missense probably benign 0.32
R5323:Pirb UTSW 7 3716599 missense possibly damaging 0.85
R5921:Pirb UTSW 7 3716694 nonsense probably null
R6316:Pirb UTSW 7 3717823 missense probably damaging 1.00
R6502:Pirb UTSW 7 3717393 missense probably benign 0.00
R6811:Pirb UTSW 7 3719642 missense possibly damaging 0.91
R7216:Pirb UTSW 7 3716274 missense probably benign 0.00
R7275:Pirb UTSW 7 3716178 missense probably benign 0.00
R7327:Pirb UTSW 7 3717188 nonsense probably null
R7582:Pirb UTSW 7 3713818 critical splice donor site probably null
R7717:Pirb UTSW 7 3717783 missense not run
R7717:Pirb UTSW 7 3717801 missense not run
R7807:Pirb UTSW 7 3719865 missense possibly damaging 0.55
R7927:Pirb UTSW 7 3719411 nonsense probably null
X0025:Pirb UTSW 7 3717268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGGATTCACTTGGAGGTGAC -3'
(R):5'- TGTCCAGACTTGGCTCTGTTAAC -3'

Sequencing Primer
(F):5'- GATTCACTTGGAGGTGACCACAC -3'
(R):5'- GGCTCTGTTAACAGGAATGCC -3'
Posted On2019-12-20