Incidental Mutation 'R7844:Olfr646'
ID606507
Institutional Source Beutler Lab
Gene Symbol Olfr646
Ensembl Gene ENSMUSG00000073931
Gene Nameolfactory receptor 646
SynonymsGA_x6K02T2PBJ9-6841330-6842268, MOR33-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104104873-104109766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 104106483 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 68 (L68W)
Ref Sequence ENSEMBL: ENSMUSP00000149102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098182] [ENSMUST00000138055] [ENSMUST00000214099]
Predicted Effect probably damaging
Transcript: ENSMUST00000098182
AA Change: L68W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095784
Gene: ENSMUSG00000073931
AA Change: L68W

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 1.9e-109 PFAM
Pfam:7TM_GPCR_Srsx 32 225 6.1e-10 PFAM
Pfam:7tm_1 38 290 3.3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214099
AA Change: L68W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Olfr646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Olfr646 APN 7 104106633 missense probably damaging 1.00
IGL02454:Olfr646 APN 7 104106612 missense probably damaging 0.96
IGL02588:Olfr646 APN 7 104107053 missense possibly damaging 0.94
IGL02961:Olfr646 APN 7 104107150 nonsense probably null
IGL03092:Olfr646 APN 7 104106647 missense probably damaging 0.99
PIT4402001:Olfr646 UTSW 7 104106450 missense probably damaging 1.00
R0006:Olfr646 UTSW 7 104106320 missense probably benign 0.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0109:Olfr646 UTSW 7 104106605 missense probably damaging 1.00
R0601:Olfr646 UTSW 7 104107142 missense possibly damaging 0.83
R0732:Olfr646 UTSW 7 104106294 missense probably damaging 1.00
R1320:Olfr646 UTSW 7 104106480 missense probably damaging 1.00
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1468:Olfr646 UTSW 7 104106689 missense possibly damaging 0.82
R1513:Olfr646 UTSW 7 104106464 missense probably benign 0.02
R5486:Olfr646 UTSW 7 104106498 missense probably damaging 0.99
R6110:Olfr646 UTSW 7 104106572 missense probably damaging 1.00
R6497:Olfr646 UTSW 7 104107215 intron probably benign
R6856:Olfr646 UTSW 7 104106791 missense probably benign 0.00
R7766:Olfr646 UTSW 7 104106994 nonsense probably null
R7789:Olfr646 UTSW 7 104106988 missense probably damaging 0.99
R7927:Olfr646 UTSW 7 104106483 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCCAAGACAGACAACAG -3'
(R):5'- CTCAGTGGGTTGCAGATAGCTAC -3'

Sequencing Primer
(F):5'- TGAGCGAAAGTCTCCCAGTC -3'
(R):5'- GCTACATATCGATCAAAGGCCATGG -3'
Posted On2019-12-20