Incidental Mutation 'R7844:Pkm'
ID606516
Institutional Source Beutler Lab
Gene Symbol Pkm
Ensembl Gene ENSMUSG00000032294
Gene Namepyruvate kinase, muscle
SynonymsPkm2, Pk-3, Pk-2, Pk3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location59656368-59679375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59670722 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 274 (H274R)
Ref Sequence ENSEMBL: ENSMUSP00000034834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034834] [ENSMUST00000163694] [ENSMUST00000213930] [ENSMUST00000215623] [ENSMUST00000215660] [ENSMUST00000216857] [ENSMUST00000217038] [ENSMUST00000217353]
Predicted Effect probably benign
Transcript: ENSMUST00000034834
AA Change: H274R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034834
Gene: ENSMUSG00000032294
AA Change: H274R

DomainStartEndE-ValueType
Pfam:PK 42 395 1.3e-172 PFAM
Pfam:PK_C 409 529 3.1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163694
AA Change: H274R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000128770
Gene: ENSMUSG00000032294
AA Change: H274R

DomainStartEndE-ValueType
Pfam:PK 42 395 2.6e-174 PFAM
Pfam:PK_C 410 528 1.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213930
Predicted Effect probably benign
Transcript: ENSMUST00000215623
Predicted Effect probably benign
Transcript: ENSMUST00000215660
Predicted Effect probably benign
Transcript: ENSMUST00000216857
Predicted Effect probably benign
Transcript: ENSMUST00000217038
Predicted Effect probably benign
Transcript: ENSMUST00000217353
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in glycolysis. The encoded protein is a pyruvate kinase that catalyzes the transfer of a phosphoryl group from phosphoenolpyruvate to ADP, generating ATP and pyruvate. This protein has been shown to interact with thyroid hormone and may mediate cellular metabolic effects induced by thyroid hormones. This protein has been found to bind Opa protein, a bacterial outer membrane protein involved in gonococcal adherence to and invasion of human cells, suggesting a role of this protein in bacterial pathogenesis. Several alternatively spliced transcript variants encoding a few distinct isoforms have been reported. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit prenatal lethality around the time of implanatation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Pkm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01693:Pkm APN 9 59670522 missense probably damaging 1.00
IGL02014:Pkm APN 9 59668961 missense possibly damaging 0.59
IGL02054:Pkm APN 9 59678201 missense probably damaging 1.00
negligible UTSW 9 59670634 missense probably damaging 1.00
R0087:Pkm UTSW 9 59678099 nonsense probably null
R0603:Pkm UTSW 9 59665881 missense probably damaging 0.97
R0940:Pkm UTSW 9 59668535 splice site probably benign
R0990:Pkm UTSW 9 59678096 missense probably damaging 1.00
R1446:Pkm UTSW 9 59668910 splice site probably null
R5104:Pkm UTSW 9 59668681 critical splice donor site probably null
R5369:Pkm UTSW 9 59670634 missense probably damaging 1.00
R6831:Pkm UTSW 9 59675115 missense probably benign
R6974:Pkm UTSW 9 59668570 missense probably damaging 0.99
R7169:Pkm UTSW 9 59671625 missense possibly damaging 0.95
R7288:Pkm UTSW 9 59668913 missense probably benign 0.00
R7621:Pkm UTSW 9 59678158 nonsense probably null
R7927:Pkm UTSW 9 59670722 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACACAGGCGCTGACTTC -3'
(R):5'- AGCCGGGTCCCAAAATGATG -3'

Sequencing Primer
(F):5'- CTCCTTGGGCAGCAAGAAG -3'
(R):5'- TGATGACTAAAAATACTTGGCCTCCC -3'
Posted On2019-12-20