Incidental Mutation 'R7844:Cfap54'
ID606522
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92902058 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 2326 (Q2326R)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000212902]
Predicted Effect probably benign
Transcript: ENSMUST00000067705
Predicted Effect unknown
Transcript: ENSMUST00000168110
AA Change: Q2261R
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: Q2261R

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212902
AA Change: Q2326R
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.46
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
R7009:Cfap54 UTSW 10 92875019 missense unknown
R7129:Cfap54 UTSW 10 93016571 missense probably benign 0.06
R7131:Cfap54 UTSW 10 92821104 missense probably benign 0.03
R7171:Cfap54 UTSW 10 92776210 missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92937728 missense unknown
R7225:Cfap54 UTSW 10 92904374 missense unknown
R7270:Cfap54 UTSW 10 92839458 missense probably benign 0.03
R7323:Cfap54 UTSW 10 92801138 missense probably benign 0.00
R7380:Cfap54 UTSW 10 93047978 missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92884703 missense unknown
R7411:Cfap54 UTSW 10 92868755 missense unknown
R7503:Cfap54 UTSW 10 92887436 intron probably null
R7622:Cfap54 UTSW 10 92956944 missense unknown
R7679:Cfap54 UTSW 10 92967512 missense probably benign 0.01
R7776:Cfap54 UTSW 10 92868741 missense unknown
R7927:Cfap54 UTSW 10 92902058 missense unknown
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Z1177:Cfap54 UTSW 10 92979026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTTAAAAGTGTGGGCCC -3'
(R):5'- GTAACATCATTCAGCATGCAAAGG -3'

Sequencing Primer
(F):5'- CCTAAACCTTTTATGAAGCACAGTG -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2019-12-20