Incidental Mutation 'R7844:Snrnp48'
ID606532
Institutional Source Beutler Lab
Gene Symbol Snrnp48
Ensembl Gene ENSMUSG00000021431
Gene Namesmall nuclear ribonucleoprotein 48 (U11/U12)
Synonyms6530403A03Rik, 1110050F08Rik
Accession Numbers

Ncbi RefSeq: NM_026382.2; MGI:1915047

Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location38204938-38227665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38209989 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 90 (E90G)
Ref Sequence ENSEMBL: ENSMUSP00000089230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091641] [ENSMUST00000178564]
Predicted Effect probably null
Transcript: ENSMUST00000091641
AA Change: E90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089230
Gene: ENSMUSG00000021431
AA Change: E90G

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:zf-U11-48K 55 79 9.9e-13 PFAM
low complexity region 292 326 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000178564
AA Change: E90G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136202
Gene: ENSMUSG00000021431
AA Change: E90G

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Pfam:zf-U11-48K 54 80 3.4e-14 PFAM
low complexity region 229 263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI

All alleles(7) : Targeted(1) Gene trapped(6)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Snrnp48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Snrnp48 APN 13 38220764 missense probably damaging 0.99
IGL02080:Snrnp48 APN 13 38216490 missense probably damaging 1.00
IGL02635:Snrnp48 APN 13 38209869 splice site probably benign
R0057:Snrnp48 UTSW 13 38216380 nonsense probably null
R1460:Snrnp48 UTSW 13 38211105 missense probably benign 0.02
R1542:Snrnp48 UTSW 13 38220704 missense probably damaging 1.00
R1789:Snrnp48 UTSW 13 38221360 missense possibly damaging 0.85
R2026:Snrnp48 UTSW 13 38209886 missense possibly damaging 0.46
R3419:Snrnp48 UTSW 13 38221359 missense possibly damaging 0.85
R3892:Snrnp48 UTSW 13 38217389 missense possibly damaging 0.93
R4485:Snrnp48 UTSW 13 38216328 missense probably benign 0.02
R4739:Snrnp48 UTSW 13 38209917 missense probably damaging 1.00
R4790:Snrnp48 UTSW 13 38221323 missense probably damaging 1.00
R5226:Snrnp48 UTSW 13 38205117 missense probably benign 0.12
R5364:Snrnp48 UTSW 13 38210189 intron probably null
R6124:Snrnp48 UTSW 13 38216463 missense possibly damaging 0.48
R6158:Snrnp48 UTSW 13 38210236 nonsense probably null
R7194:Snrnp48 UTSW 13 38209899 missense probably damaging 1.00
R7610:Snrnp48 UTSW 13 38209961 missense probably damaging 1.00
R7749:Snrnp48 UTSW 13 38221287 missense probably benign 0.00
R7927:Snrnp48 UTSW 13 38209989 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GACGCATTGAGAGAACTCCC -3'
(R):5'- TGTTAAGGATTGCACAGTTGGC -3'

Sequencing Primer
(F):5'- CACATGGGATTGAGGCCC -3'
(R):5'- CAGTTGGCTGTTTTAAGATTTGAG -3'
Posted On2019-12-20