Incidental Mutation 'R7844:Cdh18'
ID606535
Institutional Source Beutler Lab
Gene Symbol Cdh18
Ensembl Gene ENSMUSG00000040420
Gene Namecadherin 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7844 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location22549022-23474418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23410787 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 453 (W453R)
Ref Sequence ENSEMBL: ENSMUSP00000130851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164787] [ENSMUST00000165614] [ENSMUST00000167623] [ENSMUST00000226693]
Predicted Effect probably damaging
Transcript: ENSMUST00000164787
AA Change: W453R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130851
Gene: ENSMUSG00000040420
AA Change: W453R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
CA 509 596 3.7e-5 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 6.8e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165614
AA Change: W453R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128643
Gene: ENSMUSG00000040420
AA Change: W453R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
CA 76 157 4.24e-14 SMART
CA 181 266 1.37e-31 SMART
CA 290 382 2.76e-13 SMART
CA 405 486 3.86e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167623
AA Change: W399R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128011
Gene: ENSMUSG00000040420
AA Change: W399R

DomainStartEndE-ValueType
CA 22 103 4.24e-14 SMART
CA 127 212 1.37e-31 SMART
CA 236 328 2.76e-13 SMART
CA 351 414 4.15e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226693
AA Change: W453R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Slc30a6 G A 17: 74,404,093 probably null Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Cdh18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Cdh18 APN 15 23173796 missense probably damaging 0.97
IGL01663:Cdh18 APN 15 23445991 missense possibly damaging 0.92
IGL01758:Cdh18 APN 15 23474183 missense probably benign 0.20
IGL02192:Cdh18 APN 15 23460316 missense probably damaging 1.00
IGL02448:Cdh18 APN 15 23173789 missense probably benign 0.00
IGL02717:Cdh18 APN 15 23410715 nonsense probably null
IGL03241:Cdh18 APN 15 23226933 missense probably benign 0.19
IGL03268:Cdh18 APN 15 23366867 missense probably damaging 1.00
IGL03307:Cdh18 APN 15 23226786 missense probably damaging 1.00
R0316:Cdh18 UTSW 15 23366913 missense probably damaging 1.00
R0462:Cdh18 UTSW 15 23366885 missense probably damaging 1.00
R0607:Cdh18 UTSW 15 23410790 missense probably benign 0.01
R0761:Cdh18 UTSW 15 23226752 missense possibly damaging 0.87
R0973:Cdh18 UTSW 15 23473995 missense probably damaging 0.99
R1110:Cdh18 UTSW 15 23474317 missense probably benign 0.00
R1550:Cdh18 UTSW 15 23436548 missense probably damaging 1.00
R1656:Cdh18 UTSW 15 23474399 missense probably benign 0.38
R1682:Cdh18 UTSW 15 23400585 missense probably benign 0.05
R1770:Cdh18 UTSW 15 23474401 missense probably benign
R1829:Cdh18 UTSW 15 23173852 missense probably damaging 1.00
R2253:Cdh18 UTSW 15 23410805 missense probably benign 0.00
R2435:Cdh18 UTSW 15 23367008 missense probably damaging 1.00
R3914:Cdh18 UTSW 15 23410685 missense probably damaging 1.00
R3964:Cdh18 UTSW 15 23474101 missense probably benign
R4002:Cdh18 UTSW 15 23382962 missense possibly damaging 0.48
R4291:Cdh18 UTSW 15 22714551 intron probably benign
R4581:Cdh18 UTSW 15 23226783 missense probably damaging 1.00
R4604:Cdh18 UTSW 15 23474368 missense probably benign 0.05
R4625:Cdh18 UTSW 15 22714042 intron probably benign
R4786:Cdh18 UTSW 15 23410787 missense probably null 1.00
R4811:Cdh18 UTSW 15 23226791 missense probably benign 0.30
R5023:Cdh18 UTSW 15 23259666 missense probably damaging 1.00
R5094:Cdh18 UTSW 15 22714539 intron probably benign
R5278:Cdh18 UTSW 15 23474158 missense probably benign 0.04
R5416:Cdh18 UTSW 15 23226723 missense probably damaging 1.00
R5503:Cdh18 UTSW 15 23436534 missense probably damaging 0.96
R5617:Cdh18 UTSW 15 23226768 missense probably damaging 0.97
R5982:Cdh18 UTSW 15 23474216 missense possibly damaging 0.89
R6240:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6475:Cdh18 UTSW 15 23226936 missense possibly damaging 0.82
R6649:Cdh18 UTSW 15 23436534 missense possibly damaging 0.87
R6700:Cdh18 UTSW 15 23474105 missense probably benign
R6718:Cdh18 UTSW 15 23226749 missense probably benign 0.15
R6796:Cdh18 UTSW 15 23446073 missense probably damaging 1.00
R7330:Cdh18 UTSW 15 23226950 missense possibly damaging 0.46
R7429:Cdh18 UTSW 15 23366856 missense possibly damaging 0.89
R7477:Cdh18 UTSW 15 23410725 missense probably benign
R7516:Cdh18 UTSW 15 23259598 splice site probably null
R7519:Cdh18 UTSW 15 23474212 missense possibly damaging 0.68
R7575:Cdh18 UTSW 15 23400597 nonsense probably null
R7618:Cdh18 UTSW 15 23366970 missense probably damaging 1.00
R7870:Cdh18 UTSW 15 23474327 missense possibly damaging 0.94
R8288:Cdh18 UTSW 15 23445987 missense probably damaging 1.00
R8420:Cdh18 UTSW 15 23474052 missense possibly damaging 0.94
R8430:Cdh18 UTSW 15 23226684 missense probably damaging 1.00
R8916:Cdh18 UTSW 15 23410727 missense not run
Z1189:Cdh18 UTSW 15 23474283 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATGTGCTGCAATGTTGACTG -3'
(R):5'- CATCATGCTGGGATGAAAGTGAAC -3'

Sequencing Primer
(F):5'- GACTGGCTATATCAAGTTGACAGCC -3'
(R):5'- GTGAACGAAAAACTCTAAAACGTAC -3'
Posted On2019-12-20