Incidental Mutation 'R7844:Krt7'
ID606536
Institutional Source Beutler Lab
Gene Symbol Krt7
Ensembl Gene ENSMUSG00000023039
Gene Namekeratin 7
SynonymsCytokeratin 7, D15Wsu77e, Krt2-7, K7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101411043-101430313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101412634 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 54 (G54D)
Ref Sequence ENSEMBL: ENSMUSP00000069900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068904] [ENSMUST00000147662]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068904
AA Change: G54D

PolyPhen 2 Score 0.801 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000069900
Gene: ENSMUSG00000023039
AA Change: G54D

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Pfam:Keratin_2_head 43 81 3.2e-12 PFAM
Filament 84 396 1.95e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147662
SMART Domains Protein: ENSMUSP00000117046
Gene: ENSMUSG00000023039

DomainStartEndE-ValueType
Pfam:Filament 1 115 4e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation of urothelial cells without histological evidence of hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Rock1 T G 18: 10,104,173 K596Q probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Krt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Krt7 APN 15 101427085 unclassified probably benign
IGL01025:Krt7 APN 15 101423421 missense probably benign 0.17
IGL02229:Krt7 APN 15 101427616 missense probably benign 0.09
IGL03366:Krt7 APN 15 101427610 missense possibly damaging 0.87
R0256:Krt7 UTSW 15 101423309 nonsense probably null
R1648:Krt7 UTSW 15 101412567 missense probably damaging 1.00
R1696:Krt7 UTSW 15 101423426 missense probably benign 0.01
R1779:Krt7 UTSW 15 101423409 missense probably damaging 1.00
R1837:Krt7 UTSW 15 101419582 missense probably benign 0.42
R2045:Krt7 UTSW 15 101423484 unclassified probably null
R2510:Krt7 UTSW 15 101412657 missense probably benign 0.01
R2511:Krt7 UTSW 15 101412657 missense probably benign 0.01
R4041:Krt7 UTSW 15 101423280 unclassified probably null
R4729:Krt7 UTSW 15 101420558 missense probably benign 0.03
R4964:Krt7 UTSW 15 101413972 missense probably damaging 1.00
R5032:Krt7 UTSW 15 101412547 missense probably benign 0.00
R6023:Krt7 UTSW 15 101412397 intron probably benign
R6270:Krt7 UTSW 15 101419558 missense probably damaging 1.00
R7019:Krt7 UTSW 15 101413970 missense probably damaging 1.00
R7645:Krt7 UTSW 15 101412643 missense probably damaging 1.00
R7773:Krt7 UTSW 15 101414032 missense possibly damaging 0.49
R7927:Krt7 UTSW 15 101412634 missense possibly damaging 0.80
X0026:Krt7 UTSW 15 101412772 missense probably damaging 0.98
Z1177:Krt7 UTSW 15 101423467 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCCGCTATGTCCATCCAC -3'
(R):5'- GGAGAAGTACTATACAGAGCCCAC -3'

Sequencing Primer
(F):5'- GCTATGTCCATCCACTTCAGC -3'
(R):5'- CGTGGCCGGAAAGAACC -3'
Posted On2019-12-20