Incidental Mutation 'R7844:Rock1'
ID606539
Institutional Source Beutler Lab
Gene Symbol Rock1
Ensembl Gene ENSMUSG00000024290
Gene NameRho-associated coiled-coil containing protein kinase 1
Synonyms1110055K06Rik, Rock-I
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R7844 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location10064401-10181792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 10104173 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 596 (K596Q)
Ref Sequence ENSEMBL: ENSMUSP00000069549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067947]
Predicted Effect probably damaging
Transcript: ENSMUST00000067947
AA Change: K596Q

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069549
Gene: ENSMUSG00000024290
AA Change: K596Q

DomainStartEndE-ValueType
S_TKc 76 338 4.07e-97 SMART
S_TK_X 341 401 4.02e-9 SMART
low complexity region 408 419 N/A INTRINSIC
PDB:3O0Z|D 535 700 1e-101 PDB
low complexity region 715 731 N/A INTRINSIC
PDB:4L2W|B 832 914 7e-28 PDB
Pfam:Rho_Binding 948 1014 4.3e-26 PFAM
PH 1119 1319 1.19e-6 SMART
C1 1229 1283 2.64e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have open eyes at birth, omphalocele and most die soon after birth as a result of cannibalization by the mom. Survivors develop inflammation of the eyelid. Another homozygous mutant shows partial lethality around implantation and reduced cardiac fibrosis after pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016D06Rik A T 8: 11,656,174 I120K probably benign Het
4930553M12Rik T C 4: 88,868,186 E65G unknown Het
Abcg5 A T 17: 84,673,590 N190K possibly damaging Het
Abhd6 A C 14: 8,039,792 H55P probably benign Het
Acox3 A T 5: 35,607,148 Q535L probably benign Het
Adora1 A G 1: 134,203,538 W132R probably damaging Het
Armc3 A G 2: 19,254,018 I299V possibly damaging Het
Atp11a A G 8: 12,851,039 D956G possibly damaging Het
Bptf C A 11: 107,074,061 V1436F probably damaging Het
Brd9 A G 13: 73,938,533 Y51C probably damaging Het
Cdh18 T C 15: 23,410,787 W453R probably damaging Het
Cfap54 T C 10: 92,902,058 Q2326R unknown Het
Col4a2 G T 8: 11,425,453 E626* probably null Het
Dpp8 A G 9: 65,045,667 I208M probably damaging Het
Evi5 T C 5: 107,874,994 R16G probably benign Het
Gabrg1 T C 5: 70,774,332 Y356C probably damaging Het
Gbp7 G T 3: 142,536,386 V94L probably benign Het
Gm4884 A C 7: 41,040,698 Q6P probably benign Het
Gm5538 A T 3: 59,729,897 I27F probably benign Het
Gm9767 A T 10: 26,078,357 probably benign Het
Gopc T C 10: 52,339,749 S448G possibly damaging Het
Gpr15 A T 16: 58,718,510 I72N probably damaging Het
Hsd17b11 T A 5: 104,018,266 T76S probably damaging Het
Inhbe A G 10: 127,350,910 S134P possibly damaging Het
Inpp4b G A 8: 81,741,320 probably benign Het
Ipo9 A G 1: 135,394,324 V556A probably benign Het
Klhdc2 T A 12: 69,302,406 F106I probably damaging Het
Krt7 G A 15: 101,412,634 G54D possibly damaging Het
Mecom T G 3: 30,009,824 Y39S unknown Het
Mrpl49 C T 19: 6,055,170 R87H probably damaging Het
Nfat5 A G 8: 107,358,668 D531G probably damaging Het
Nlrp9a A T 7: 26,562,581 K718N possibly damaging Het
Ogfr AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG 2: 180,595,057 probably benign Het
Olfr646 T G 7: 104,106,483 L68W probably damaging Het
Pigu A C 2: 155,292,720 Y388* probably null Het
Pirb A T 7: 3,719,411 C144* probably null Het
Pkm A G 9: 59,670,722 H274R probably benign Het
Plch2 C A 4: 154,989,465 D927Y probably damaging Het
Scaper A T 9: 55,815,448 M692K probably benign Het
Serpine1 C A 5: 137,071,189 G39* probably null Het
Serpine2 T C 1: 79,816,799 Q139R probably benign Het
Sipa1l1 C A 12: 82,397,493 R993S probably damaging Het
Slc12a9 T C 5: 137,332,186 T86A probably damaging Het
Snrnp48 A G 13: 38,209,989 E90G probably null Het
Spdl1 A T 11: 34,813,343 N554K possibly damaging Het
Spon1 G A 7: 114,030,332 V404I probably benign Het
Tada3 C T 6: 113,370,960 R300H probably benign Het
Tcl1b5 G A 12: 105,176,556 probably null Het
Tdrd9 A G 12: 111,997,952 Y336C possibly damaging Het
Timm44 A G 8: 4,269,976 L64P possibly damaging Het
Tpo A G 12: 30,100,405 L492P probably damaging Het
Trip11 T G 12: 101,878,144 Q1565P probably damaging Het
Trpm2 A G 10: 77,923,506 I1148T probably benign Het
Tshz1 T C 18: 84,014,171 E704G probably benign Het
Tysnd1 C T 10: 61,702,165 R541* probably null Het
Other mutations in Rock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Rock1 APN 18 10080502 missense probably benign 0.44
IGL01535:Rock1 APN 18 10132119 splice site probably benign
IGL01751:Rock1 APN 18 10079113 critical splice donor site probably null
IGL01752:Rock1 APN 18 10079113 critical splice donor site probably null
IGL02318:Rock1 APN 18 10104323 splice site probably benign
IGL02420:Rock1 APN 18 10070619 splice site probably null
IGL03030:Rock1 APN 18 10070215 splice site probably benign
IGL03339:Rock1 APN 18 10097493 missense probably benign 0.00
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0480:Rock1 UTSW 18 10079120 missense possibly damaging 0.92
R0538:Rock1 UTSW 18 10132227 missense possibly damaging 0.53
R0719:Rock1 UTSW 18 10099328 missense probably damaging 1.00
R1033:Rock1 UTSW 18 10067535 missense probably benign 0.12
R1448:Rock1 UTSW 18 10070233 missense probably damaging 1.00
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1694:Rock1 UTSW 18 10136094 critical splice donor site probably null
R1862:Rock1 UTSW 18 10079207 missense probably damaging 0.99
R1995:Rock1 UTSW 18 10101026 nonsense probably null
R2177:Rock1 UTSW 18 10070263 missense probably benign 0.18
R2892:Rock1 UTSW 18 10072863 nonsense probably null
R3780:Rock1 UTSW 18 10067575 missense probably benign 0.00
R3884:Rock1 UTSW 18 10122768 missense probably damaging 1.00
R4352:Rock1 UTSW 18 10079237 missense probably damaging 1.00
R4414:Rock1 UTSW 18 10080514 missense probably damaging 1.00
R4646:Rock1 UTSW 18 10112391 missense probably benign
R4694:Rock1 UTSW 18 10136152 nonsense probably null
R4888:Rock1 UTSW 18 10122698 missense probably benign 0.06
R5085:Rock1 UTSW 18 10140210 missense probably damaging 1.00
R5884:Rock1 UTSW 18 10099361 missense probably benign 0.03
R5927:Rock1 UTSW 18 10116792 missense probably damaging 1.00
R6084:Rock1 UTSW 18 10101007 missense probably benign 0.15
R6151:Rock1 UTSW 18 10106426 missense possibly damaging 0.79
R6360:Rock1 UTSW 18 10116778 missense possibly damaging 0.52
R6892:Rock1 UTSW 18 10122612 missense probably benign 0.00
R7313:Rock1 UTSW 18 10129317 missense possibly damaging 0.73
R7397:Rock1 UTSW 18 10097599 missense possibly damaging 0.80
R7488:Rock1 UTSW 18 10122762 missense probably damaging 1.00
R7515:Rock1 UTSW 18 10067631 missense probably damaging 0.97
R7567:Rock1 UTSW 18 10090820 missense probably benign 0.35
R7569:Rock1 UTSW 18 10140194 missense probably damaging 1.00
R7639:Rock1 UTSW 18 10140244 missense probably damaging 1.00
R7836:Rock1 UTSW 18 10097651 splice site probably null
R7919:Rock1 UTSW 18 10097651 splice site probably null
R7927:Rock1 UTSW 18 10104173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTGATAACTAATCCCAACCTCTC -3'
(R):5'- AACATGATCGTGTTTGGTCAAA -3'

Sequencing Primer
(F):5'- CTCTGACGGTAAAGGGCTAACC -3'
(R):5'- CAGAATCAGACACAGCTG -3'
Posted On2019-12-20