Incidental Mutation 'R7845:Dars2'
ID606543
Institutional Source Beutler Lab
Gene Symbol Dars2
Ensembl Gene ENSMUSG00000026709
Gene Nameaspartyl-tRNA synthetase 2 (mitochondrial)
Synonyms5830468K18Rik
Accession Numbers

Ncbi RefSeq: NM_172644.3; MGI: 2442510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7845 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location161040601-161070658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 161041748 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 644 (S644T)
Ref Sequence ENSEMBL: ENSMUSP00000041851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035430]
Predicted Effect probably benign
Transcript: ENSMUST00000035430
AA Change: S644T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041851
Gene: ENSMUSG00000026709
AA Change: S644T

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 65 148 7e-10 PFAM
Pfam:tRNA-synt_2 165 607 1.2e-90 PFAM
Pfam:GAD 355 451 2e-13 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. It is a mitochondrial enzyme that specifically aminoacylates aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). [provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast1 C A 8: 84,925,325 E343* probably null Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Dars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Dars2 UTSW 1 161053939 critical splice donor site probably null
R0230:Dars2 UTSW 1 161062787 missense probably benign 0.02
R0537:Dars2 UTSW 1 161060748 missense possibly damaging 0.46
R0709:Dars2 UTSW 1 161046928 missense probably benign 0.00
R1365:Dars2 UTSW 1 161044994 nonsense probably null
R1502:Dars2 UTSW 1 161046805 nonsense probably null
R1625:Dars2 UTSW 1 161054044 missense possibly damaging 0.88
R1934:Dars2 UTSW 1 161063241 splice site probably null
R2239:Dars2 UTSW 1 161063282 missense possibly damaging 0.83
R3721:Dars2 UTSW 1 161063308 missense probably benign 0.03
R4308:Dars2 UTSW 1 161041721 missense probably damaging 0.98
R4786:Dars2 UTSW 1 161060760 missense probably damaging 1.00
R4859:Dars2 UTSW 1 161044990 missense probably damaging 0.99
R4903:Dars2 UTSW 1 161051371 missense probably benign 0.06
R5042:Dars2 UTSW 1 161045094 intron probably benign
R5068:Dars2 UTSW 1 161041913 missense probably benign 0.02
R6257:Dars2 UTSW 1 161041828 missense probably damaging 1.00
R7286:Dars2 UTSW 1 161046808 missense possibly damaging 0.85
R7346:Dars2 UTSW 1 161046772 splice site probably null
R7444:Dars2 UTSW 1 161046884 missense possibly damaging 0.94
R7593:Dars2 UTSW 1 161057543 missense probably damaging 1.00
X0063:Dars2 UTSW 1 161056493 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TGCTTGGAAAACAGGAAGACTC -3'
(R):5'- AGACTGGTATGTCTTGTCACG -3'

Sequencing Primer
(F):5'- TTCCACAGACAGTCCTAATGG -3'
(R):5'- TATGTCTTGTCACGGGAGCACC -3'
Posted On2019-12-20