Incidental Mutation 'R7845:Olfr1340'
ID606550
Institutional Source Beutler Lab
Gene Symbol Olfr1340
Ensembl Gene ENSMUSG00000070821
Gene Nameolfactory receptor 1340
SynonymsGA_x6K02T2QD9B-18823451-18822504, MOR258-6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7845 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location118720138-118729395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118726961 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 238 (M238T)
Ref Sequence ENSEMBL: ENSMUSP00000149563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094834] [ENSMUST00000213436] [ENSMUST00000216242] [ENSMUST00000217334]
Predicted Effect probably benign
Transcript: ENSMUST00000094834
AA Change: M238T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092430
Gene: ENSMUSG00000070821
AA Change: M238T

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 4.4e-57 PFAM
Pfam:7tm_1 44 293 1.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213436
AA Change: M238T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000216242
AA Change: M238T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000217334
AA Change: M238T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast1 C A 8: 84,925,325 E343* probably null Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Olfr1340
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0153:Olfr1340 UTSW 4 118726333 missense possibly damaging 0.86
R0335:Olfr1340 UTSW 4 118727170 missense probably null
R0517:Olfr1340 UTSW 4 118726634 missense probably damaging 1.00
R4463:Olfr1340 UTSW 4 118726658 missense probably benign 0.32
R6240:Olfr1340 UTSW 4 118726471 missense probably benign 0.00
R6481:Olfr1340 UTSW 4 118726733 missense probably damaging 1.00
R6930:Olfr1340 UTSW 4 118727141 missense probably damaging 1.00
R7662:Olfr1340 UTSW 4 118726307 missense probably damaging 0.99
R7681:Olfr1340 UTSW 4 118726564 missense probably benign 0.00
R7782:Olfr1340 UTSW 4 118726909 missense probably damaging 1.00
T0970:Olfr1340 UTSW 4 118726267 missense probably benign
Z1176:Olfr1340 UTSW 4 118727141 missense probably damaging 1.00
Z1177:Olfr1340 UTSW 4 118727064 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGGCCCCAATGAGATCAAC -3'
(R):5'- AGAAAGCCTTCTTCACATCCTTG -3'

Sequencing Primer
(F):5'- CCAATGAGATCAACCACTTCTTTTG -3'
(R):5'- ACATCCTTGTTCCGGAGACTG -3'
Posted On2019-12-20