Incidental Mutation 'R7845:Slc2a1'
ID606551
Institutional Source Beutler Lab
Gene Symbol Slc2a1
Ensembl Gene ENSMUSG00000028645
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 1
SynonymsGlut1, Glut-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7845 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location119108711-119137983 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 119135928 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 425 (V425A)
Ref Sequence ENSEMBL: ENSMUSP00000030398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030398] [ENSMUST00000134105] [ENSMUST00000144329] [ENSMUST00000174372] [ENSMUST00000208090]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030398
AA Change: V425A

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030398
Gene: ENSMUSG00000028645
AA Change: V425A

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 467 1e-164 PFAM
Pfam:MFS_1 24 418 1.6e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134105
SMART Domains Protein: ENSMUSP00000118641
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 12 128 7.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144329
SMART Domains Protein: ENSMUSP00000134126
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 4 123 1.5e-35 PFAM
Pfam:MFS_1 5 123 3.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174372
SMART Domains Protein: ENSMUSP00000134714
Gene: ENSMUSG00000028645

DomainStartEndE-ValueType
Pfam:Sugar_tr 16 173 9.3e-53 PFAM
Pfam:MFS_1 18 172 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208090
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major glucose transporter in the mammalian blood-brain barrier. The encoded protein is found primarily in the cell membrane and on the cell surface, where it can also function as a receptor for human T-cell leukemia virus (HTLV) I and II. Mutations in this gene have been found in a family with paroxysmal exertion-induced dyskinesia. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous null embryos are small, lack visibly detectable eyes, show a diminutive rostral embryonic pole and an overall developmental delay, and die at E10-E14. Heterozygotes show spontaneous seizures, impaired motor performance, hypoglycorrhachia, microencephaly, and reduced brain glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast1 C A 8: 84,925,325 E343* probably null Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Slc2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Slc2a1 APN 4 119132238 missense possibly damaging 0.94
IGL01876:Slc2a1 APN 4 119133378 missense probably benign 0.11
IGL02355:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
IGL02362:Slc2a1 APN 4 119136415 missense possibly damaging 0.61
R1076:Slc2a1 UTSW 4 119134448 missense probably damaging 0.98
R1561:Slc2a1 UTSW 4 119136409 missense possibly damaging 0.86
R1616:Slc2a1 UTSW 4 119136306 missense probably damaging 1.00
R3015:Slc2a1 UTSW 4 119132143 missense probably damaging 1.00
R4166:Slc2a1 UTSW 4 119133116 missense probably damaging 0.97
R4795:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R4796:Slc2a1 UTSW 4 119132445 missense probably damaging 0.99
R6025:Slc2a1 UTSW 4 119136342 missense possibly damaging 0.68
R7403:Slc2a1 UTSW 4 119132555 missense probably damaging 1.00
R7429:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7430:Slc2a1 UTSW 4 119136313 missense probably damaging 1.00
R7524:Slc2a1 UTSW 4 119132612 missense probably damaging 1.00
R7692:Slc2a1 UTSW 4 119136265 missense probably damaging 1.00
R7768:Slc2a1 UTSW 4 119132447 missense probably damaging 1.00
R8236:Slc2a1 UTSW 4 119133257 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTATCTCCCTCAACAGGAACGG -3'
(R):5'- CTGTGACAGGCTCCAGAAAC -3'

Sequencing Primer
(F):5'- ATGTCCTATCTGAGCATCGTGGC -3'
(R):5'- CAGGCTCCAGAAACGGCATG -3'
Posted On2019-12-20