Incidental Mutation 'R0178:Cers5'
ID60657
Institutional Source Beutler Lab
Gene Symbol Cers5
Ensembl Gene ENSMUSG00000023021
Gene Nameceramide synthase 5
SynonymsCerS5, Trh4, 2310081H14Rik, Lass5
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0178 (G1)
Quality Score118
Status Validated
Chromosome15
Chromosomal Location99734881-99772885 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 99747024 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023762] [ENSMUST00000109035] [ENSMUST00000175876] [ENSMUST00000176248] [ENSMUST00000176627]
Predicted Effect probably benign
Transcript: ENSMUST00000023762
SMART Domains Protein: ENSMUSP00000023762
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 9e-17 BLAST
HOX 78 140 5.6e-2 SMART
TLC 139 340 4.35e-76 SMART
low complexity region 343 361 N/A INTRINSIC
low complexity region 366 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109035
SMART Domains Protein: ENSMUSP00000104663
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 6e-17 BLAST
HOX 78 140 5.6e-2 SMART
TLC 139 340 4.35e-76 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175876
SMART Domains Protein: ENSMUSP00000134845
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
HOX 29 91 5.6e-2 SMART
TLC 90 241 1.29e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176248
SMART Domains Protein: ENSMUSP00000135074
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
Blast:TLC 24 66 9e-18 BLAST
HOX 78 140 2.8e-4 SMART
TLC 139 251 1.7e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176627
SMART Domains Protein: ENSMUSP00000134988
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
HOX 27 89 5.6e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176970
SMART Domains Protein: ENSMUSP00000135723
Gene: ENSMUSG00000023021

DomainStartEndE-ValueType
TLC 1 153 3.49e-25 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the TLC (TRAM, LAG1 and CLN8 homology domains) family of proteins. The encoded protein functions in the synthesis of ceramide, a lipid molecule that is involved in a several cellular signaling pathways. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Colec12 C T 18: 9,858,921 P568L unknown Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Cers5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Cers5 APN 15 99739655 nonsense probably null
coleman UTSW 15 99751238 nonsense probably null
R0483:Cers5 UTSW 15 99745914 missense probably damaging 1.00
R0589:Cers5 UTSW 15 99740956 missense probably damaging 1.00
R1433:Cers5 UTSW 15 99745931 nonsense probably null
R1757:Cers5 UTSW 15 99736331 missense probably benign 0.31
R2520:Cers5 UTSW 15 99736381 missense probably damaging 0.97
R3008:Cers5 UTSW 15 99772717 unclassified probably benign
R3010:Cers5 UTSW 15 99772717 unclassified probably benign
R3011:Cers5 UTSW 15 99772717 unclassified probably benign
R4379:Cers5 UTSW 15 99751253 missense probably damaging 1.00
R4732:Cers5 UTSW 15 99741637 missense probably benign 0.38
R4733:Cers5 UTSW 15 99741637 missense probably benign 0.38
R4911:Cers5 UTSW 15 99747079 missense probably damaging 1.00
R5441:Cers5 UTSW 15 99751238 nonsense probably null
R6089:Cers5 UTSW 15 99741002 missense probably benign 0.01
R6161:Cers5 UTSW 15 99738663 critical splice donor site probably null
R6247:Cers5 UTSW 15 99745924 missense probably benign 0.03
R6300:Cers5 UTSW 15 99772219 missense probably damaging 1.00
R6312:Cers5 UTSW 15 99747115 missense probably benign 0.11
R6861:Cers5 UTSW 15 99772363 unclassified probably benign
R7780:Cers5 UTSW 15 99739708 missense probably damaging 1.00
R7800:Cers5 UTSW 15 99736241 missense probably benign 0.02
R7843:Cers5 UTSW 15 99772331 missense unknown
R7995:Cers5 UTSW 15 99740942 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAATCATGTTGCCTTAGTGGCAGG -3'
(R):5'- TGCGGGAGTCCCCAAGACATATAG -3'

Sequencing Primer
(F):5'- CCTTAGTGGCAGGTAGGACC -3'
(R):5'- TGGAGAAGGCATGTTCTAACTC -3'
Posted On2013-07-24