Incidental Mutation 'R7845:Mis18bp1'
ID606574
Institutional Source Beutler Lab
Gene Symbol Mis18bp1
Ensembl Gene ENSMUSG00000047534
Gene NameMIS18 binding protein 1
SynonymsC79407
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7845 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location65132734-65172604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65149328 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 554 (I554T)
Ref Sequence ENSEMBL: ENSMUSP00000052109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052201] [ENSMUST00000221296] [ENSMUST00000222244]
Predicted Effect probably benign
Transcript: ENSMUST00000052201
AA Change: I554T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000052109
Gene: ENSMUSG00000047534
AA Change: I554T

DomainStartEndE-ValueType
low complexity region 319 332 N/A INTRINSIC
Pfam:SANTA 336 425 1.4e-27 PFAM
coiled coil region 428 448 N/A INTRINSIC
coiled coil region 645 668 N/A INTRINSIC
SANT 742 794 9.48e-6 SMART
low complexity region 874 884 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149986
Predicted Effect probably benign
Transcript: ENSMUST00000221296
Predicted Effect probably benign
Transcript: ENSMUST00000222244
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast1 C A 8: 84,925,325 E343* probably null Het
Micu1 T C 10: 59,839,785 probably null Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rbp3 G T 14: 33,956,464 A790S probably benign Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Mis18bp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Mis18bp1 APN 12 65158441 missense possibly damaging 0.68
IGL01383:Mis18bp1 APN 12 65148989 missense probably benign 0.05
IGL01736:Mis18bp1 APN 12 65138678 missense probably damaging 1.00
IGL02037:Mis18bp1 APN 12 65136748 critical splice donor site probably null
IGL02210:Mis18bp1 APN 12 65136831 nonsense probably null
IGL02318:Mis18bp1 APN 12 65158741 missense probably benign 0.04
IGL02541:Mis18bp1 APN 12 65161460 missense probably damaging 0.97
IGL02664:Mis18bp1 APN 12 65153880 nonsense probably null
IGL02838:Mis18bp1 APN 12 65136826 missense probably damaging 0.99
IGL03031:Mis18bp1 APN 12 65161930 missense probably benign
PIT4453001:Mis18bp1 UTSW 12 65158673 missense probably damaging 0.98
R0555:Mis18bp1 UTSW 12 65161453 missense possibly damaging 0.94
R1169:Mis18bp1 UTSW 12 65143283 nonsense probably null
R1517:Mis18bp1 UTSW 12 65133813 missense probably benign 0.03
R1702:Mis18bp1 UTSW 12 65161744 missense probably benign
R1705:Mis18bp1 UTSW 12 65149339 missense probably benign 0.19
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1888:Mis18bp1 UTSW 12 65149328 missense probably benign 0.01
R1973:Mis18bp1 UTSW 12 65149076 nonsense probably null
R1990:Mis18bp1 UTSW 12 65158694 missense probably benign 0.03
R2023:Mis18bp1 UTSW 12 65149109 missense probably damaging 0.97
R2043:Mis18bp1 UTSW 12 65149418 missense probably damaging 1.00
R2318:Mis18bp1 UTSW 12 65140843 missense possibly damaging 0.92
R2897:Mis18bp1 UTSW 12 65133586 missense probably benign 0.09
R3120:Mis18bp1 UTSW 12 65156988 splice site probably null
R3845:Mis18bp1 UTSW 12 65149142 missense possibly damaging 0.61
R4578:Mis18bp1 UTSW 12 65153881 missense probably damaging 1.00
R4590:Mis18bp1 UTSW 12 65158506 missense possibly damaging 0.50
R4614:Mis18bp1 UTSW 12 65153529 intron probably benign
R4626:Mis18bp1 UTSW 12 65140766 missense probably damaging 1.00
R4724:Mis18bp1 UTSW 12 65158739 missense probably benign 0.18
R4873:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R4875:Mis18bp1 UTSW 12 65161435 missense probably benign 0.23
R5173:Mis18bp1 UTSW 12 65149375 missense possibly damaging 0.96
R5294:Mis18bp1 UTSW 12 65157043 missense probably damaging 1.00
R5540:Mis18bp1 UTSW 12 65148746 missense possibly damaging 0.83
R5560:Mis18bp1 UTSW 12 65152816 missense possibly damaging 0.83
R5584:Mis18bp1 UTSW 12 65154776 missense probably damaging 0.98
R5661:Mis18bp1 UTSW 12 65148852 missense probably benign 0.41
R6235:Mis18bp1 UTSW 12 65158408 missense probably damaging 0.99
R6282:Mis18bp1 UTSW 12 65149163 missense probably benign 0.01
R6284:Mis18bp1 UTSW 12 65138787 missense probably benign 0.32
R6378:Mis18bp1 UTSW 12 65149247 missense probably benign 0.11
R6418:Mis18bp1 UTSW 12 65158543 missense possibly damaging 0.64
R7103:Mis18bp1 UTSW 12 65149283 missense possibly damaging 0.61
R7244:Mis18bp1 UTSW 12 65161630 missense probably damaging 0.96
R7371:Mis18bp1 UTSW 12 65158594 missense probably benign 0.18
R7623:Mis18bp1 UTSW 12 65148852 missense probably benign 0.05
R7898:Mis18bp1 UTSW 12 65149472 missense probably benign 0.41
R7912:Mis18bp1 UTSW 12 65152758 missense possibly damaging 0.92
R8057:Mis18bp1 UTSW 12 65148899 missense possibly damaging 0.56
X0058:Mis18bp1 UTSW 12 65149226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCAGTTTTGAGGGCAAC -3'
(R):5'- TGATCCCTTGAACTCACTGGAAC -3'

Sequencing Primer
(F):5'- CAGTTTTGAGGGCAACTTGTTC -3'
(R):5'- TGGAACAGCCTACCTCCG -3'
Posted On2019-12-20