Incidental Mutation 'R7845:Rbp3'
ID606577
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R7845 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33956464 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 790 (A790S)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably benign
Transcript: ENSMUST00000035695
AA Change: A790S

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: A790S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (43/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,309 H483R probably damaging Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Acot2 G T 12: 83,992,988 G424* probably null Het
Adat2 G T 10: 13,552,997 probably benign Het
Bcl2l2 A G 14: 54,884,851 Y157C unknown Het
Bglap2 T A 3: 88,378,694 probably benign Het
Ccdc14 T C 16: 34,715,364 L495P probably damaging Het
Cobl T C 11: 12,365,139 D275G probably benign Het
Cpne2 A G 8: 94,551,204 N72S probably benign Het
D7Ertd443e A G 7: 134,270,248 F628S probably damaging Het
Dars2 A T 1: 161,041,748 S644T probably benign Het
Depdc5 A G 5: 32,903,915 probably null Het
Dip2c A G 13: 9,609,044 S860G probably damaging Het
Dnajc21 T G 15: 10,447,141 H507P probably damaging Het
Eif2ak2 G T 17: 78,863,898 Q359K probably damaging Het
Epha8 T C 4: 136,936,401 E448G probably benign Het
Exoc3l G C 8: 105,290,150 S677R probably damaging Het
Fads1 T A 19: 10,194,041 H345Q probably damaging Het
Fam118a T A 15: 85,045,851 D93E possibly damaging Het
Fam135a T C 1: 24,029,657 I710M probably benign Het
Fbxw14 T A 9: 109,287,603 I13F probably damaging Het
Gemin6 A G 17: 80,225,661 S8G probably benign Het
Ints2 A T 11: 86,238,263 M498K possibly damaging Het
Man2a2 G C 7: 80,368,865 A82G probably benign Het
Mast1 C A 8: 84,925,325 E343* probably null Het
Micu1 T C 10: 59,839,785 probably null Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mrps28 T A 3: 8,923,715 N28Y possibly damaging Het
Mtpap T A 18: 4,387,134 S395T possibly damaging Het
Muc16 A T 9: 18,640,773 H4741Q probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1294 C A 2: 111,538,167 G41* probably null Het
Olfr1340 T C 4: 118,726,961 M238T probably benign Het
Olfr564 G A 7: 102,804,285 R269Q not run Het
Ptx4 T C 17: 25,124,954 Y393H possibly damaging Het
Ranbp2 G A 10: 58,447,022 V15M probably damaging Het
Rfx6 T A 10: 51,678,026 S73T probably benign Het
Sec14l3 T A 11: 4,067,972 M84K probably benign Het
Sec23b T A 2: 144,559,396 V59E possibly damaging Het
Slc2a1 T C 4: 119,135,928 V425A possibly damaging Het
Stab2 A T 10: 86,996,894 V89D probably benign Het
Stra8 A G 6: 34,930,964 D117G probably benign Het
Syt17 A T 7: 118,409,971 I338N possibly damaging Het
Tas2r136 T A 6: 132,777,870 Y98F probably benign Het
Tsks C A 7: 44,953,744 probably null Het
Wdr62 A G 7: 30,265,242 V359A possibly damaging Het
Xrcc6 T C 15: 82,016,477 probably null Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
Behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
Rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4385:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33955840 missense probably benign
R7756:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7758:Rbp3 UTSW 14 33954775 missense probably benign 0.15
R7784:Rbp3 UTSW 14 33954158 missense probably benign 0.41
R8176:Rbp3 UTSW 14 33955648 missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33956363 missense probably benign 0.00
R8393:Rbp3 UTSW 14 33956199 missense possibly damaging 0.93
Z1177:Rbp3 UTSW 14 33954538 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CTCATAGAGGCTCTGTTCAAAAC -3'
(R):5'- AGGTCCTGCATAGTGTGAGC -3'

Sequencing Primer
(F):5'- GCTCTGTTCAAAACGGATGTGCTAC -3'
(R):5'- CATAGTGTGAGCAAAGGCCTC -3'
Posted On2019-12-20