Incidental Mutation 'R0178:Colec12'
ID60658
Institutional Source Beutler Lab
Gene Symbol Colec12
Ensembl Gene ENSMUSG00000036103
Gene Namecollectin sub-family member 12
SynonymsCL-P1, SRCL, Scara4
MMRRC Submission 038446-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.685) question?
Stock #R0178 (G1)
Quality Score202
Status Validated
Chromosome18
Chromosomal Location9707648-9877995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9858921 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 568 (P568L)
Ref Sequence ENSEMBL: ENSMUSP00000043220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040069]
PDB Structure
Mouse Scavenger Receptor C-type Lectin carbohydrate-recognition domain. [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000040069
AA Change: P568L
SMART Domains Protein: ENSMUSP00000043220
Gene: ENSMUSG00000036103
AA Change: P568L

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 112 157 N/A INTRINSIC
low complexity region 205 211 N/A INTRINSIC
coiled coil region 217 247 N/A INTRINSIC
low complexity region 268 280 N/A INTRINSIC
low complexity region 369 385 N/A INTRINSIC
Pfam:Collagen 441 499 1.4e-10 PFAM
Pfam:Collagen 482 548 9.6e-10 PFAM
Pfam:Collagen 530 591 3.8e-11 PFAM
CLECT 607 731 4.19e-36 SMART
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.1%
  • 10x: 95.5%
  • 20x: 88.8%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. This protein is a scavenger receptor, a cell surface glycoprotein that displays several functions associated with host defense. It can bind to carbohydrate antigens on microorganisms, facilitating their recognition and removal. It also mediates the recognition, internalization, and degradation of oxidatively modified low density lipoprotein by vascular endothelial cells. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700125H20Rik A G 11: 85,178,438 H94R probably benign Het
4922502D21Rik T C 6: 129,326,823 R60G probably benign Het
4930596D02Rik T G 14: 35,811,478 N111T probably benign Het
9930021J03Rik A G 19: 29,754,788 S342P probably damaging Het
Abca1 T C 4: 53,081,953 D769G possibly damaging Het
Adcy6 G T 15: 98,604,215 Q173K probably benign Het
Amotl1 G A 9: 14,548,773 A890V probably benign Het
Arfgap2 C T 2: 91,267,361 A141V probably benign Het
Asb2 G A 12: 103,325,552 P324L probably damaging Het
Cacna1g G A 11: 94,463,483 T202I probably damaging Het
Capn5 A G 7: 98,132,891 L214P probably damaging Het
Cdh20 A T 1: 104,975,051 D489V possibly damaging Het
Cers5 C A 15: 99,747,024 probably benign Het
Chrnb3 T A 8: 27,393,364 V111D probably damaging Het
Cyp2r1 T C 7: 114,550,408 E248G probably damaging Het
Dnmt3b A G 2: 153,675,018 T536A probably benign Het
Eef2 G A 10: 81,180,292 V496M possibly damaging Het
Fam118a T C 15: 85,045,880 probably benign Het
Fer1l6 T A 15: 58,637,914 probably null Het
Fhad1 A C 4: 141,955,340 F497V probably benign Het
Gbe1 G A 16: 70,478,386 G358D probably damaging Het
Gdf10 A G 14: 33,924,101 D69G probably damaging Het
Ggt6 A G 11: 72,436,818 H150R possibly damaging Het
Gm1966 A T 7: 106,601,821 Y739N probably damaging Het
Gm45713 A T 7: 45,134,458 L110Q probably damaging Het
Gm9847 T C 12: 14,494,648 noncoding transcript Het
Grwd1 T C 7: 45,830,630 E51G probably damaging Het
H13 A G 2: 152,681,067 Y100C probably damaging Het
Kcne1 A C 16: 92,348,809 M49R probably damaging Het
Kcnma1 C T 14: 23,526,767 R236H probably damaging Het
Knl1 T A 2: 119,058,405 probably benign Het
Krt40 T C 11: 99,541,739 I150M probably damaging Het
Ldb2 A T 5: 44,473,499 V300E probably damaging Het
Lrp1b A T 2: 40,725,907 C3606S probably damaging Het
Lrrc42 A G 4: 107,247,720 I16T probably damaging Het
Lrrc6 A C 15: 66,454,101 D208E probably benign Het
Mtus1 G T 8: 41,002,361 L87I possibly damaging Het
Myot T C 18: 44,336,986 F10S probably damaging Het
Nrg3 A T 14: 38,376,456 H480Q probably damaging Het
Olfr205 A T 16: 59,329,420 F30I probably damaging Het
Olfr691 G A 7: 105,336,922 R265C probably benign Het
Prl2c5 A T 13: 13,191,805 D220V probably damaging Het
Rbm17 G A 2: 11,587,779 S295L probably benign Het
Serpina6 A G 12: 103,646,913 I376T probably damaging Het
Sh2d2a A T 3: 87,849,423 T192S probably benign Het
Slc27a1 T C 8: 71,584,462 Y417H possibly damaging Het
Slc6a1 T G 6: 114,304,852 I32S possibly damaging Het
Sntb1 T C 15: 55,906,144 T150A probably damaging Het
Tanc1 T A 2: 59,835,447 C1183* probably null Het
Tmprss7 C A 16: 45,690,843 W57C probably damaging Het
Ubac1 A T 2: 26,021,428 V36E possibly damaging Het
Zfc3h1 T C 10: 115,406,725 probably benign Het
Zfp644 C T 5: 106,636,905 C592Y probably damaging Het
Other mutations in Colec12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Colec12 APN 18 9848826 missense probably damaging 1.00
IGL02477:Colec12 APN 18 9859858 missense unknown
R0128:Colec12 UTSW 18 9858921 missense unknown
R0130:Colec12 UTSW 18 9858921 missense unknown
R0179:Colec12 UTSW 18 9858921 missense unknown
R0180:Colec12 UTSW 18 9848890 missense probably damaging 0.99
R0180:Colec12 UTSW 18 9858921 missense unknown
R0318:Colec12 UTSW 18 9848446 missense possibly damaging 0.77
R0344:Colec12 UTSW 18 9858921 missense unknown
R0573:Colec12 UTSW 18 9858650 missense probably damaging 0.97
R1028:Colec12 UTSW 18 9866837 missense unknown
R1693:Colec12 UTSW 18 9866765 missense unknown
R1951:Colec12 UTSW 18 9859975 critical splice donor site probably null
R2008:Colec12 UTSW 18 9874813 missense probably benign 0.03
R2181:Colec12 UTSW 18 9846828 missense probably damaging 0.99
R4258:Colec12 UTSW 18 9720950 missense probably damaging 1.00
R4794:Colec12 UTSW 18 9848984 missense probably damaging 0.99
R5269:Colec12 UTSW 18 9846825 missense possibly damaging 0.67
R5369:Colec12 UTSW 18 9866750 missense unknown
R5421:Colec12 UTSW 18 9858580 missense probably damaging 1.00
R5608:Colec12 UTSW 18 9848267 missense possibly damaging 0.95
R5668:Colec12 UTSW 18 9848963 missense probably damaging 1.00
R5684:Colec12 UTSW 18 9849009 missense probably damaging 0.99
R6547:Colec12 UTSW 18 9840351 missense probably damaging 1.00
R7194:Colec12 UTSW 18 9848248 missense probably benign 0.08
R7253:Colec12 UTSW 18 9848922 missense probably damaging 1.00
Z1088:Colec12 UTSW 18 9848727 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- ACCTGGTCCAACTGGCAACAAG -3'
(R):5'- GCCAAGCCTACACACTGCCTTATTC -3'

Sequencing Primer
(F):5'- GGCACAATTGGACCAGTCG -3'
(R):5'- TTCCTCCACAATTCTAGCTGAGAAG -3'
Posted On2013-07-24